|
||
Chain in Forming Preimmune TCR Repertoire Revealed by Clonal TCR Reconstitution System
Address correspondence to T. Saito, Dept. of Molecular Genetics, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan. Phone: 81-43-226-2197; Fax: 81-43-222-1791; E-mail: saito{at}med.m.chiba-u.ac.jp
| Abstract |
|---|
|
|
|---|
and -ß chains play central roles in the recognition of antigen (Ag)-MHC complex. TCR repertoire is created on the basis of Ag recognition specificity by CDR3s. To analyze the potential spectrum of TCR-
and -ß to exhibit Ag specificity and generate TCR repertoire, we established hundreds of TCR transfectants bearing a single TCR-
or -ß chain derived from a cytotoxic T cell (CTL) clone, RT-1, specific for HIVgp160 peptide, and randomly picked up TCR-ß or -
chains. Surprisingly, one-third of such TCR-ß containing random CDR3ß from naive T cells of normal mice could reconstitute the antigen-reactive TCR coupling with RT-1 TCR-
. A similar dominant function of TCR-
in forming Ag-specific TCR, though low-frequency, was obtained for lymphocytic choriomeningitis virusspecific TCR. Subsequently, we generated TCR-
and/or -ß transgenic (Tg) mice specific for HIVgp160 peptide, and analyzed the TCR repertoire of Ag-specific CTLs. Similar to the results from TCR reconstitution, TCR-
Tg generated CTLs with heterogeneous TCR-ß, whereas TCR-ß Tg-induced CTLs bearing a single TCR-
. These findings of Ag recognition with minimum involvement of CDR3ß expand our understanding regarding the flexibility of the spectrum of TCR and suggest a predominant role of TCR-
chain in determining the preimmune repertoire of Ag-specific TCR.
Key Words: antigen recognition CDR3 CTL HIV gp160 selection
| Introduction |
|---|
|
|
|---|
and -ß chains, which are both generated by somatic rearrangements of germline-encoded V, D, and J gene segments (1). TCR-
and -ß chains both contain three complementarity-determining regions (CDRs), which exhibit extreme variability and are responsible for specificity. While CDR1 and 2 are encoded by germline V gene segments, CDR3 is somatically created by rearrangement of V, (D), and J segments and provides major contributions to TCR diversity (13). It has been theorized that the diversity of TCR-
ß can reach 1015 by random rearrangement and nucleotide addition (1), and that a single peptide/MHC complex positively selects at least 105 different Vß rearrangements (4). Recent estimations of the functional repertoire of peripheral T cells by extensive sequencing of CDR3 regions have suggested that actual diversity is more limited than the theoretical assumption and that the size of the Vß repertoire is 510 x 105 and the total clone size will be as small as 2 x 106 (57).
The diversity of TCR-
is shaped by numerous V
and J
genes and one N region, while the TCR-ß chain is created by smaller numbers of Vß and Jß, two Cß, but a greater contribution of two N regions. During T cell development, TCR-
rearrangement takes place in thymocytes which had undergone TCR-ß rearrangement. This order of TCR rearrangement results in a significant difference between TCR-
and -ß on the peripheral TCR repertoire at a single cell level. T cells bearing the same TCR-ß and varied TCR-
chains could be generated because immature T cells expressing a TCR-ß chain and a preT cell receptor exhibit proliferation before TCR-
rearrangement. On the contrary, a given TCR-
could not associate with multiple TCR-ß chains under physiological condition. This may lead to the hypothesis that TCR-
exhibits a greater diversity than TCR-ß chains and plays more important roles in the recognition of foreign antigen. In addition, a considerable percentage of T cells expresses two rearranged TCR-
chains (8), probably as a result of thymic selection of TCR, which may possibly occur through receptor editing (9, 10). Recently, several different class Irestricted TCRs and one class IIrestricted TCR have been crystallized in complex with corresponding peptide/MHC (1116). In most cases, it was shown that TCR-
has more contacts with peptide than TCR-ß, pointing to the possibility that peptide recognition predominantly depends on TCR-
.
In addition to these structural analyses, analysis of single TCR-transgenic (Tg)* mice has provided additional insight into the functional aspects of the structure of Ag recognition and TCR repertoire (17). Brandle et al. analyzed the TCR repertoire of lymphocytic choriomeningitis virus (LCMV)-specific CTLs upon virus infection in TCR-
or TCR-ß Tg mice and found that CTLs used highly restricted VJ
and more diverse VDJß junctional regions (18). Furthermore, several experiments have analyzed the responses to altered peptide ligands in these Tg mice (3, 1921) and demonstrated that every mutation in Ag peptide resulted in a change in the CDR3 sequences of TCR-
and -ß chains, which supported the model in which CDR3 loops are laid directly upon the peptide bound to the MHC groove.
Nevertheless, these analyses using Tg mice have suffered from obvious limitations in determining the potential repertoire of TCR-
ß pairs, because TCRs with strong (autoreactive) affinity, or without, to self-MHC were excluded through thymic selection. In addition, since TCR-
expression is not allelically excluded, unlike TCR-ß and T cells express two TCR-
chains, simple sequencing of TCR-
cDNA cannot determine which combination of a TCR-
ß dimer exhibits Ag specificity.
To overcome such limitations and analyze the preselection repertoire, we developed a novel transfection system that determines the precise mechanism of Ag recognition and allows analysis of the functional TCR repertoire at the clonal level. This system enabled us to systematically analyze hundreds of individual TCR-
ß pairs for Ag-specific recognitions without the influence of thymic selection. In this study, we analyzed the repertoire of endogenous TCR associated with transgenic TCR chain in HIVgp160-specific CTLs in vitro using our transfection system as well as in vivo by creating single TCR-Tg mice. We found that in order to recognize the HIVgp160 peptide/H-2Dd complex, CTLs have to possess a single TCR-
chain but can use a variety of TCR-ß chains. Our results with two Ag systems suggest that recognition of foreign antigens is predominantly dependent on TCR-
chain and that the diversity of TCR develops in accordance with the heterogeneity of TCR-
, which would preclude the problems of autoimmunity and unwanted deletion of useful T cell clones.
| Materials and Methods |
|---|
|
|
|---|
and -ß chains that has been used as recipient cells for TCR transfection (23). The sequences of Ag peptides are as follows: P18IIIB (315329:RIQRGPGRAFVTIGK); P18MN (315329:RIHIGPGRAFYTTKN); and LCMV p33 (KAVYNFATM).
Subcloning of TCR.
CD8+ T cells or CD69+ CD8+ blast T cells were purified by FACStarTM sorting with a purity >98%, and total cellular RNA from these cells was extracted as described previously (24). cDNA was synthesized with random hexamer primers and Superscript II cDNA synthesis kit (GIBCO BRL).
The primers used for cloning of V
42H11+ TCR-
chain were: V
42H11: ATGCTGATTCTAAGCCTGTT; and C
: TCAACTGGACCACAGCCT. The primers used for CDR3ß cloning were: common Vß8 family: GGGCTGAGGCTGATCCATTA; and Cß: CCAAGCACACGAGGGTAG. The primers for the full-length TCR-ß cloning were: Vß8.1: ATGGGCTCCAGACTCTTC; Vß8.3: ATGGGCTCCAGGCTCTTTCT; and Cß: TCAGGAATTTTTTTTCTTGACCAT. These primers contained EcoRI and NotI sites at 5' ends to subclone into pMX-IRES-GFP (provided by Toshio Kitamura, Tokyo University, Tokyo, Japan.). Each cloned plasmid DNA was purified by Wizzard Plus SV DNA Purification System (Promega) and sequenced using BigDye Terminator Cycle Sequencing Ready Reagent (PE Biosystems) with an ABI 377 DNA sequencer.
Retrovirus-mediated Gene Transfer.
A recipient T cell line for expression of a variety of TCR-
ß dimers was prepared by electroporation of the expressible constructs of CD8
and CD8ß in the pBCMGneo (provided by H. Nakauchi, Tsukuba University, Tsukuba, Japan) into TG40 cells by GenePulser (Bio-Rad Laboratories). Various TCR-ß chains in pMX-IRES-GFP vector, were transfected into a retroviral packaging cell line, Phoenix (from G. Nolan, Stanford University, Stanford, CA), with LipofectAMIN Plus Reagent (GIBCO BRL). The culture supernatant of Phoenix after 24 h culture was collected, centrifuged at 8,000 g for 16 h to concentrate the virus, and added to CD8
ßexpressing TG40 cells together with DOTAP Liposomal Transfection Reagent (Boehringer Mannheim). Transfection was monitored by the intensity of GFP and the cell surface expression of TCR by FACS® analysis. Transfection of a variety of TCR-ß chains into CD8+ TCR-
+ TG40 cells resulted in 2540% of surface TCR+ cells.
IL-2 Production Assay.
To analyze the IL-2 secretion from various TCR-transfected TG40 cells, 2 x 104 TG40 transfectants were cultured with 106 of irradiated BALB/c splenocytes in 200 µl of complete RPMI 1640 medium in the presence of 4 µM of various peptides in a 96-well flat-bottomed plate for 24 h. As a positive control for stimulation through the TCR complex, cells were plated in 200 µl of complete RPMI 1640 medium in a 96-well flat-bottomed plate precoated with 1 µg/ml antiTCR-ß mAb, H57 (provided by R. Kubo, La Jolla Institute of Allergy and Immunology, San Diego, CA). The titer of IL-2 in the culture supernatant was determined by ELISA.
Establishment of Transgenic Mice.
The transgenic TCR-
and -ß genes were isolated from RT1. The TCR-
and -ß genes responsible for the recognition of P18/Dd were first analyzed by PCR using specific primers for V
and Vß, and C
and Cß, respectively. The DNA sequences of the PCR products revealed that RT1-TCR-
was composed of V
42H11 and J
25 and the TCR-ß chain of Vß8.1, Jß2.1, and Cß2. A full-length TCR-
was generated by inserting the junctional sequence into a TCR-
cDNA clone containing V
42H11 (a gift from B. Huber, Tufts University, MA) at the site of SmaI and EcoRV. A full-length TCR-ß chain was similarly constructed by recombinant PCR using pP142ß8AR (TCR-ß from a LCMV-specific CTL clone, P14, which was provided by H. Pircher, Freiburg University, Germany) as a template. The full-length cDNAs of RT1-TCR-
ß genes were subcloned into the SalI and BamHI sites of the expression vector pHSE3' under control of the H-2Kb promoter (provided by H. Pircher). The inserts of these expression constructs for each TCR-
and -ß were injected into C57BL/6 oocytes, and two lines of Tg mice were generated. Tg lines with higher expression of TCR-
and -ß were extensively analyzed. Tg mice were backcrossed with BALB/c mice for six generations for the experiments. Details of the establishment and characteristic of Tg mice will be described elsewhere (unpublished data).
Ag-specific Cytotoxicity Assay.
Cytolytic activity of CTLs was measured by standard 51Cr release assay (25). Briefly, 5 x 106 freshly isolated splenocytes from RT1-TCR-Tg were stimulated in vitro with 2 x 105 of the gp160-transfected NIH 3T3 cells in 2 ml of complete RPMI 1640 medium containing 10% ConA supernatant. After 5-d culture, effector cells were mixed with peptide-pulsed NIH 3T3 target cells for 5 h and the 51Cr counts in the culture supernatant were measured. The percentage of specific cytotoxicity was calculated as 100 x (experimental release - spontaneous release)/maximum release - spontaneous release).
Proliferation Assay.
CD8+ T cells (>98%) were purified from splenocytes of RT1-TCR-Tg or non-Tg mice by cell sorting with FACStarTM plus (Becton Dickinson). 5 x 104 CD8+ T cells were cultured with 106 irradiated BALB/c splenocytes in 200 µl of complete RPMI medium with 4 µM Ag peptide. Culture plates were pulsed with 2 µCi/well of 3[H]-thymidine for 8 h on day 3, and the incorporated radioactivity was measured by Microbeta scintillation counter (Amersham Pharmacia Biotech).
Flow Cytometric Analysis.
Cell surface expression of Vß8+ TCR-ß chain was analyzed by staining with three different anti-Vß8 mAbs: F23.1 and F23.2 (provided by P. Marrack, National Jewish Center, Denver, CO) for Vß8.1+Vß8.2+Vß8.3 and for Vß8.2, KJ16 (Caltag) for Vß8.11Vß8.2, together with anti-CD8
mAb (536.7) (BD PharMingen). 106 cells were incubated with Ab for 40 min, followed with biotin antimouse IgG Ab (BD PharMingen) for 40 min. After blocking with mouse serum, cells were incubated with anti-CD8
FITC and streptoavidinPE (BD PharMingen) for 30 min. Stained cells were analyzed by flow cytometry with FACScaliburTM (Becton Dickinson).
| Results |
|---|
|
|
|---|
ß Pairs.
or ß) is transfected into a TCR-deficient cell line with a variety of the other TCR chains (ß or
), and the specificity of a given TCR-
ß pairs is analyzed. We focused on the Ag-recognizing repertoire by the TCR-
and -ß chains derived from an HIV gp160-specific, H-2Ddrestricted cytotoxic T cell clone, RT1 (22). This clone recognizes the HIV env peptide P18IIIB. We first determined the usage of TCR-
and -ß chains of this clone by RT-PCR and 5' RACE (data not shown). RT1-TCR-
chain was found to be composed of V
42H11 and J
25 and RT1-TCR-ß chain of Vß8.1, Jß2.1, and Cß2. We designed a system to analyze the specificity of TCR-
ß by creating a series of TCR-
ß dimers either by reconstituting a TCR-
ß dimer with the RT1-TCR-
chain and a variety of TCR-ß chains or with the RT1-TCR-ß chain and various TCR-
chains.
First, in order to analyze Ag-recognition by TCR dimers composed of the fixed RT1-TCR-ß chain with various TCR-
chains,
30 TCR-
chains bearing V
42H11 were isolated from unimmunized normal mice. These TCR-
chains contained random J and N region sequences (data not shown). Each V
42H11+TCR-
chain was subcloned into a retrovirus vector and then transfected by retrovirus-mediated gene transfer into a TCR-
ßdeficient recipient T cell hybridoma cell line, TG40 (23), in which RT1-TCR-ß and CD8
ß had been transfected and expressed. Expression of each transfected TCR-
chain was monitored by the cell surface expression of the TCRCD3 complex. Approximately 3060% of the transfectants expressed the cell surface TCR complex, and the expression levels of the TCR complex were almost the same among these transfectants. A representative profile of such transfection is shown in Fig. 1
. Functional specificity of the reconstituted TCR was assessed by measuring IL-2 production upon stimulation with specific Ag peptide, P18IIIB plus APC (Dd), or anti-TCR-ß mAb cross-linking as the control. As postulated, all of the 29 different V
42H11-bearing TCR-
chains with various junctional sequences isolated from unimmunized mice failed to reconstitute any TCR-
ß complex reactive to the P18IIIB/H-2Dd complex when coexpressed with RT1-TCR-ß chain and CD8, while all clones produced a similar level of IL-2 upon anti-TCR-ß Ab cross-linking (Fig. 1).
|
chain and a variety of TCR-ß chains derived from unimmunized naive T cells. More than 80 TCR-ß chains expressing Vß8.1 and either of Jß2.1, Jß2.2, or Jß2.4 were randomly picked up. All of these TCR-ß chains were transfected into TG40 cells expressing RT1
and CD8. These TCR-ß chains were able to pair with the RT1-TCR-
chain and were expressed on the cell surface in a similar manner to that shown in Fig. 1 (data not shown). These transfectants expressing RT1
and various TCR-ß were then tested for their reactivity to P18IIIB/H-2Dd for Ag-specific IL-2 production. To our surprise, an extremely high frequency of TCR-ß chains (45% [13/29]) of Jß2.1+, 54% [7/13] of Jß2.2+, and 18% [6/33] of Jß2.4+ TCR-ß chains) could reconstitute TCRs with RT1-TCR-
as well as recognize P18IIIB/H-2Dd and secrete IL-2 (Fig. 2)
. As a sum, one-third (25 of 75) of randomly picked-up TCR-ß chains from nonTg naive T cells could generate P18/Dd-specific TCRs when reconstituting a TCR with the RT1-TCR-
chain at the clonal level. As shown in Fig. 3
, the analysis of amino acid sequences of the CDR3 regions of the TCR-ß chains from these transfectants revealed no obvious difference either in the sequence or in the length of the CDR3ß regions (26) between the Ag-reactive and nonreactive TCR-ß chains. To examine the functional sensitivity of the reconstituted TCRs to Ag, Ag doseresponses were analyzed on several representative transfectants expressing three different Jßs, Jß2.1, Jß2.2, and Jß2.4 (Fig. 4) . We found that the dose responses were clearly dependent on the structure of Jß. While TCR reconstituted with Jß2.2-containing TCR-ß chains were more sensitive than RT1-TCR-
ß, Jß2.1-positive TCR-ß chains provided similar levels of response to RT1ß-TCR-
ß. In contrast, TCRs with Jß2.4-bearing ß chains exhibited less sensitive doseresponses compared with RT1-TCR-
ß, though they were still within the physiological range (Fig. 4).
|
|
|
|
ß pairs reactive to Ag, a high frequency of irrelevant Vß8+ TCR-ß chains can form a functional TCR-
ß dimer with RT1-TCR-
chain so as to be able to respond to physiological concentrations of the HIVgp160 V3 loop peptide.
Requirement of Single TCR-
and Heterogeneous TCR-ß for Ag Recognition in Single TCR Tg Mice.
To examine whether the observed high frequency of TCR-ß to constitute Ag-recognizing TCR with the RT1-
chain reflects the in vivo preimmune repertoire of peripheral T cells, we established transgenic mice expressing either RT1-TCR-
or -ß chain (
Tg and ßTg), respectively, using an expression vector containing H-2b promoter, pHSE3' (27). Immune responses of CD8+ cells from these mice to P18IIIB/H-2Dd were then analyzed. The expression of transgenic TCR-
and -ß chains was confirmed by RT-PCR and also by cell surface staining of TCR-ß chain with anti-Vß8 mAb and TCR-
ß dimer with clonotypic mAb on T cells from each kind of Tg mouse (data not shown).
Ag-specific immune responses of CD8+ T cells from each of the single TCR-
and TCR-ß Tg mice as well as from TCR-
ß Tg mice were analyzed by measuring Ag-specific proliferation and cytotoxic function. CD8+ T cells from
ßTg mice exhibited P18IIIB-specific proliferation (Fig. 5
A) as well as Ag-specific cytolytic activity against P18IIIB-pulsed NIH 3T3 target cells (Fig. 5 B, a). As expected from the results of in vitro TCR reconstitution experiments, primary CD8+ T cells isolated from unimmunized
Tg mice showed strong proliferative responses to P18IIIB/H-2Dd, and the responses were more intensive than those from ßTg mice (Fig. 5 A). In contrast, CD8+ T cells from ßTg exhibited a significant, though weak, proliferative response to P18IIIB (Fig. 1 A). In accordance with the proliferation, CD8+ T cells from
Tg mice exhibited P18IIIB-specific cytotoxicity as strongly as that of
ßTg mice after 5-d culture with gp160-expressing cells (Fig. 5 B, b). Surprisingly, CD8+ T cells from ßTg mice showed significant cytotoxicity at approximately one-third of the magnitude of CTLs from
ßTg mice (Fig. 5 B, c). Collectively, these results demonstrated that TCR Tg could develop Ag-reactive CD8+ T cells upon Ag stimulation and that the actual TCR repertoire reactive to the antigen was much larger in
Tg mice than in ßTg, indicating that the Ag recognition of P18IIIB appeared to be mediated mainly by the TCR-
chain.
We then analyzed the clonal basis of Ag-specific recognition by single TCR Tg mice by determining their TCR repertoire of specific CTLs. First, we analyzed TCR-ß chain usage of Ag-specific CTLs generated from
Tg mice. In the FACS® analysis of Vß repertoires,
30% of unstimulated CD8+ T cells from
Tg mice expressed Vß8, similar to normal mice, but the total of Vß8+ CD8+ T cells in
Tg mice was 92% after Ag stimulation, with an especially high expression of Vß8.1 (71%) (Fig. 6
A and B). Contrary to the strong skewing in the Vß repertoire, the junctional sequences of Vß8+ TCR-ß chains from Ag-stimulated CD8+ T cells from
Tg mice revealed no predominant usage of any single Jß gene segment and no differences in the lengths and amino acid sequences of CDR3ß residues (Fig. 6 C). We next compared the junctional diversity of the V
42H11+ TCR-
chains of Ag-stimulated CD8+ T cells from ßTg mice with naive ßTg mice. In sharp contrast, we found that only a single J
gene segment, J
25, which is the same as the original RT1 clone, and almost the same CDR3
sequences dominated in V
42H11+ TCR-
chains from Ag-stimulated CD8+ T cells from ßTg mice (Fig. 7
A). It is unlikely that the restriction in TCR-
usage was due to thymic selection during T cell development, since J
and CDR3
residues were found to be variable in nonstimulated CD8+ cells from ßTg mice (Fig. 7 B).
|
|
chain and heterogeneous TCR-ß chains were used to recognize P18IIIB/Dd in vivo.
Another TCR Model for Ag Recognition by a Single TCR-
and a Variety of TCR-ß Chains.
This unexpectedly high frequency of CDR3ß sequences giving rise to a functional TCR-
ß pair with a single TCR-
chain was not peculiar to the RT1-TCR and P18IIIB/H-2Dd system. To generalize from this observation, we used the same approach to the well-established P14-TCR, which exhibits LCMV-specific, H-2Db-restricted Ag recognition. Brandle et al. reported that P14-TCR
-Tg mice, in contrast to P14-TCRß-Tg mice, were capable of responding to the LCMV glycoprotein peptide (GP33) in vitro, suggesting that the TCR-
chain plays a dominant role in GP33/H-2Db recognition (28). We reconstituted the TCR-
ß dimer by transfection of the P14-TCR-
chain and a variety of Vß8+ TCR-ß chains isolated from naive T cells of non-Tg mice and measured the reactivity to the LCMV epitope GP33/H-2Db. The results revealed that three out of 73 clones (4%) showed Ag-specific IL-2 production when expressed with the P14-TCR-
chain (Fig. 8
A). These three TCRß chains did not have any sequence similarity in the CDR3ß regions (Fig. 8 B). There was no positive response to either GP33 or P18IIIB when any one of the three ß chains was expressed with RT1-TCR-
chain (data not shown). The frequency of functionally reconstituted TCR-
ß dimers composed of P14-TCR-
and randomly cloned TCR-ß was much lower than that in the case of RT1-TCR (Fig. 5). Nevertheless, since the frequency for a particular TCR chain to form an Ag-specific TCR dimer with a nonselected partner chain has been believed to be extremely low, the 4% level of randomly picked-up TCR-ß chains was sufficient to illustrate high frequency.
|
| Discussion |
|---|
|
|
|---|
ßdeficient cell line was first transfected with a particular TCR-
, followed by further transfection with a variety of randomly cloned TCR-ß chains, and each transfectant expressing a pair of TCR-
ß dimers was assessed for its ability to recognize Ag peptide-triggered IL-2 production. Using this system, we were able to analyze hundreds of individual TCR-
ß dimers for the specificity of Ag recognition. In general, the TCR repertoire has until now been analyzed by determining sequences of TCR after establishing T cell clones and isolation of cDNA. However, the finding that many T cells express two allelically unexcluded functional TCR-
chains (8) made it difficult to determine the TCR-
ß dimer responsible for the Ag recognition by simple sequencing. Our system is able to analyze the specificity of the individual pair of TCR-
ß chains systematically, and further, it can analyze the repertoire without the influence of thymic selection.
When expressing various TCR-ß chains together with the RT1-TCR-
chain, one-third of the randomly picked-up Vß8+ TCR-ß chains containing random CDR3ß from naive T cells of nonTg mice could generate the specific TCR-
ß dimers that recognize the P18IIIB/H-2Dd complex. The result that Ag-specific TCR can be reconstituted at such an extremely high frequency could not be expected except in the case of superantigen. Since the recognition is strongly restricted by Vß8, Vß may have contribution to the contact with MHCpeptide. Nevertheless, this result indicates that Ag recognition by RT1-TCR is not dependent on particular CDR3ß. We applied a similar analysis to the LCMV-specific P14 Tg mouse, one of the widely used Tg mice.
It has been demonstrated that CTLs from P14-TCR-
Tg showed specific cytotoxic function, and T cells from P14-TCR-ß Tg mice revealed a restricted repertoire of TCR-
chain (18, 28), suggesting that TCR-
plays a dominant role in Ag recognition. In our clonal TCR reconstitution analysis, transfection of various TCR-ß chains containing random CDR3ß together with the P14-TCR-
chain revealed that 4% of Vß8+ TCR-ß chains were able to generate functional TCR-
ß recognizing GP33/H-2Db. This percentage, though much smaller than that of RT1, still represents an extremely high frequency from the viewpoint of randomly rearranged TCRs. It was not at all expected that the combination of a particular TCR-
chain and randomly obtained TCR-ß chains from naive mice that have not been selected with the TCR-
chain could generate an Ag-specific TCR-
ß dimer. Collectively, the predominant contribution of TCR-
chain may vary depending on the T cell clone. Ag recognition by RT1-TCR with a minimum involvement of CDR3ß is probably an extreme case, and P14-TCR exhibits Ag recognition with a little less independence of CDR3ß than RT1-TCR.
A number of analyses of the T cell repertoire have been based on the use of single TCR Tg mice. In some of them, TCR-
and -ß appeared to contribute equally to Ag recognition (3, 29), whereas in other cases Ag recognition was profoundly dependent on TCR-
(1820, 30, 31). We also analyzed the in vivo functional TCR repertoire of HIV-P18-specific CTLs by generating single TCR Tg mice to compare the endogenous TCR repertoires. In our transgenic systems, CTLs generated from RT1-ßTg mice upon stimulation with Ag peptide exhibited weak but still significant Ag-specific cytotoxicity. Sequence analysis revealed that these CTLs expressed a homogeneous TCR-
chain, V
42H11-J
25, as did the original RT1-TCR-
chain.
Since unstimulated T cells have completely heterogeneous TCR-
similar to naive T cells, only the T cells expressing the single RT1-TCR-
chain were selected and expanded. Indeed, we observed that a majority of CD8+ T cell blasts became clonotype-positive after Ag-specific stimulation (data not shown). In contrast, CTLs from
Tg mice showed cytotoxicity as strong as
ßTg mice in spite of the random usage of Jß and CDR3ß sequences. These results strongly suggest that RT1-TCR-
chain played a predominant role even in the in vivo recognition of P18IIIB/H-2Dd. Although the relative dependency on TCR-
chain in Ag recognition has been described in several systems (3, 19, 3134), this is the first example of a single TCR-
being used to generate functional Ag-specific CTLs with various TCR-ß chains.
The observation in single TCR Tg analyses that RT1-TCR-
chain could generate functional Ag-reactive TCRs with various Vß8+ TCR-ß chains at a high frequency similar to the in vitro TCR reconstitution system indicates that the clonal size expressing RT1
chain in preimmune repertoire is very small and only RT1
+ T cells expand after Ag stimulation. This result may reflect the fact that the functional assembly of TCR-
chains with a defined TCR-ß is more easily formed than that of TCR-ß chains with a defined TCR-
in the physiological repertoire. These functional constraints of TCR assembly are created during selection of the TCR repertoires in the thymus.
Since TCR-
rearrangement takes place after TCR-ß and the probability of generating identical V
-J
joints in a T cell expressing a rearranged TCR-ß is thought to be virtually nil, the chance for a single TCR-
chain to pair with multiple TCR-ß chains would be extremely small. In contrast, since extensive proliferation occurs after TCR-ß rearrangement, each TCR-ß would be expressed in numerous immature T cells and pair with multiple TCR-
chains. If a TCR-ß chain had the capacity to exhibit Ag specificity with multiple TCR-
chains, Ag stimulation would activate a large number of T cell clones with a variety of avidities, including clones reactive to other Ags as well as possibly self-antigens. Moreover, negative selection in the thymus may delete otherwise useful TCR-
ß pairs, as they also react to self-antigens. However, as shown in this study, a TCR-ß chain paired with distinct TCR-
chains creates individually well-defined Ag specificities. This system reflects the mechanism for ensuring self-tolerance and generating the diversity of the T cell repertoire.
In the in vivo peripheral repertoire, each TCR-
chain pairs in principle with a unique TCR-ß chain because of the order of TCR rearrangement/selection, avoiding the problems of autoimmunity and unwanted deletion of useful T cell clones. The assembly of the same ß chain with a distinct
chain may exhibit different Ag specificity. Therefore, analyzing a particular pair of TCR-
ß cannot provide the potential capability of TCR-
to assemble with other ß. The issue of whether the possible assembly of
chain with other ß creates TCR with the same Ag specificity during T cell selection has been kept unsolved. Our present analysis could demonstrate for the first time by changing TCR composed of various TCR-ß and -
defined TCR-
that multiple TCR-ß can create the same Ag specificity if the rearranged ß has a chance to assemble with a single TCR-
during generation of the T cell repertoire.
Recent crystallographic analyses of the trimolecular complex, TCR-
ß and peptideMHC revealed that CDR1, CDR2, and CDR3
ß regions generally contribute to the buried surface area in the interface, and subsequently a dominant role of the V
domain in peptide recognition was acknowledged (1115). The distribution of the buried surface area by CDR3
has been shown to be greater than by CDR3ß in 2C-TCR (12). In the case of D10-TCR, 23 of 27 atomic contacts with the peptide involve V
and only 4 involve Vß (14). In addition, these reports suggested that the pivot point and the orientation angle between TCR and peptide/MHC might regulate the contact sites of CDR3
to the peptide.
These results imply that TCR-
chain may present dominant contribution to Ag recognition, which is consistent with our results of extensive functional analysis of RT1- and P14-TCR. Although CDR3ß residues can be random for P18IIIB/H-2Dd recognition, the Vß usage is restricted to be Vß8, suggesting that Vß contributes to the contact with MHC and/or peptide. The actual structural basis of Ag recognition with random CDR3ß will have to wait for the crystallographic analysis of the RT1-TCR-
ß/P18IIIB/H-2Dd trimolecular complex.
This study suggests the predominant role of TCR-
in the formation of the functional preimmune TCR repertoire. Numerous analyses of T cell clones and populations mostly by analyzing the junctional sequences of TCR have not been able to determine the functional contribution of TCR-
versus TCR-ß in Ag recognition, as simple determination of each TCR sequence does not reveal functional TCR dimers. It has been postulated that CDR3
and CDR3ß may equally contribute to most Ag recognition in general. Thus, the median of the dependency on CDR3
versus CDR3ß for Ag recognition was postulated to be located in the middle of the distribution.
Our approach by functional and clonal TCR reconstitution unveiled the existence of TCR recognition with minimum involvement of CDR3ß and predominant dependency on TCR-
. Together with structural data, it can now be postulated that Ag recognition is mediated predominantly by TCR-
and the contribution of TCR-
versus TCR-ß on Ag recognition may be shifted toward TCR-
. A considerable proportion of T cells expresses two TCR-
chains after possible receptor editing during thymic selection (8). Although the physiological meaning of two TCR-
on a single T cell is not yet clear, one of the possibilities is a role in the shifting of the TCR contribution to Ag recognition toward TCR-
. Systematic analysis of functional repertoire as shown in the present study as well as structural determination of various TCR-
ß dimers may provide the whole profile of the Ag recognition structure by TCR-
ß.
| Acknowledgments |
|---|
This work was supported by a grant-in-aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.
Submitted: May 14, 2001
Revised: February 15, 2002
Accepted: March 1, 2002
| Footnotes |
|---|
* Abbreviations used in this paper: LCMV, lymphocytic choriomeningitis virus; Tg, transgenic.
| References |
|---|
|
|
|---|
ß TCR repertoire of naive mouse splenocytes. J. Immunol. 164:57825787.
ß T cell receptor diversity. Science. 286:958961.
ß T cell responses. Semin. Immunol. 11:423431.
chains: dual receptor T cells. Science. 262:422424.
-J
segment by secondary rearrangement in the thymus: role of continuous rearrangement of TCR
chain gene and positive selection in the T cell repertoire formation. Proc. Natl. Acad. Sci. USA. 95:1183411839.
ß T cells deal with induced TCR
ablation. Proc. Natl. Acad. Sci. USA. 98:87448749.
ß T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science. 274:209219.
ß T-cell receptor, influenza HA peptide and MHC class II molecule, HLA-DR1. EMBO J. 19:56115624.
and an antigenic peptide bound to MHC class I. J. Immunol. 167:43964404.
and Vß variable region domains and
chain junctional region in viral antigen recognition. Eur. J. Immunol. 21:21952202.
ß receptor. EMBO J. 7:37453755.
chain. Eur. J. Immunol. 25:26502655.
chains. J. Immunol. 157:47264735.
This article has been cited by other articles:
| ||||||||||||