From the Basel Institute for Immunology, CH-4005 Basel, Switzerland
 |
Introduction |
The
/
T lymphocytes use clonally distributed TCR
to recognize cell-bound antigens, usually in the form
of peptides embedded in MHC molecules. The
/
TCR
is an oligomeric complex containing variable, covalently
bound
and
chains responsible for antigen recognition
and four noncovalently associated monomorphic subunits, CD3
,
,
, and
chain. The invariant subunits are crucial
for efficient assembly of the TCR and, hence, for surface
expression (1). In addition, they couple extracellular ligand
binding into cytoplasmic signaling machinery and, therefore, form an essential and the most proximal component
of TCR signal transduction (2).
Although some of the sequential biogenesis steps of the
TCR complex are quite well-characterized, the final complex on the cell surface is surprisingly poorly defined: not
only is the overall topology of the complex unknown, but so
is even the basic stoichiometry of the TCR, the most commonly proposed structure being TCR

2CD3

2 (1).
Recently resolved three-dimensional structures of ectodomains of TCR
and
/
chains have now offered some
potential insights into the puzzle of the TCR complex topology (3). The most striking feature of the structure of
the C
domain is the large 14-amino acid long FG loop
that protrudes freely into the solvent on the external face of
the C
domain. It was soon proposed that this loop would
interact with CD3 and, therefore, be part of the relay team
in TCR signal transduction (3). Recent more detailed structural analyses and simple elegant antibody/epitope mapping
of the TCR have added further details and suggested that
the loop would form part of the interface between CD3
and the C
domain (6, 7).
Here we report our finding that the TCR
chain lacking
the complete 14-amino acid FG loop is able to support normal T cell development and function in transgenic mice.
 |
Materials and Methods |
TCR-
Mutagenesis.
A retroviral expression vector LXSN
coding for the wild-type TCR
chain (V
8.2-J
2.1) cDNA was
used as template for mutagenesis. Deletion of the region corresponding to the 14-amino acid FG loop of the C
domain was
performed by linking PCR. A 1:1 ratio of the products from PCR 1 (5' oligo of V
8.2 GAATTCCTTGAGCTCAAGATGGGCTCCAGGCTCTTC [oligo A] and 3' oligo spanning the deletion
GTTCTGTGTGACCCCAT GGA AC TGCACT TGGCAGCG)
and PCR 2 (5' oligo spanning the deletion CAGTTCCATGGGGTCACACAGAACATCAGTGCAGAG and 3' oligo containing
the stop codon AGGATCCTCATGAGTTTTTTCTTTTGAC
[oligo B]) was used as template for PCR 3 (oligo A and B). The
PCR product was digested with EcoRI and BamHI and cloned
into an EcoRI and BamHI-opened retroviral vector LXSN. Deletion (underlined amino acids 231-244) GLSEEDKWPEGSPKPV
was then verified by DNA sequencing. Transgenic vectors were as
described previously (8).
Transfection of Cell Lines.
Infectious retroviral stocks were
generated by transfecting packaging cell lines GP+E-86 (9) with
retroviral expression vectors LXSN (neomycin resistant) coding
for wild-type or mutant TCR
chain, or vectors LXSP (puromycin resistant) coding for wild-type TCR
chain (V
4-J
47).
The supernatants from appropriately selected packaging cell lines
were used to infect TCR
hybridomas. The wild-type
or mutant
chain were first introduced into the hybridomas, and after
neomycin selection (G418, 1 mg/ml) these lines were superinfected separately with TCR
chain as described previously (10).
The cell lines were then cultured in IMDM supplemented with
2% FCS, G418, and puromycin (10 µg/ml). TCR expression
was tested by FACS® as soon as 4 d after selection. Stable transfectants were maintained in G418 and puromycin-containing medium.
Mice.
BALB/c and C56BL/6 mice were purchased from
IFFA-Credo. The TCR-
knock-out mice have already been
described (11), and were bred in our specific pathogen-free animal facility with the wild-type TCR-
or mutant TCR-
transgenic mice.
Flow Cytometry and Antibodies.
Immunofluorescence stainings
were done as described previously (12). Flow cytometric analysis
was performed with a FACSCaliburTM equipped with CellQuest
software (Becton Dickinson). The reagents used were mAbs biotinylated 145-2C11 (anti-CD3
), PE-labeled RM4-5 (anti-CD4)
and FITC-labeled H57-597 (anti-C
) (13), B20.1 (anti-V
2), RR3-16 (anti-V
3.2), B21-14 (anti-V
8), and RR8-1 (anti-V
11.1, 2) (all seven mAbs purchased from PharMingen), Cy5-labeled 53-6.7 (anti-CD8), fluorescein-succinimidyl-ester (FLUOS)-
labeled F23.1 (anti-V
8.1, 2, 3) (14), and second-step reagent
streptavidin-allophycocyanin (APC) (Molecular Probes, Inc.).
T Cell Functional Assays.
For T cell proliferation, 2 × 105
spleen cells were cultured in triplicate with various concentrations
of staphylococcal enterotoxin B (SEB) and SEC 2 superantigens
in 200 µl of IMDM supplemented with 10% FCS in 96-well flat-bottomed plates. Proliferative responses were assessed after 48 h
of culture. Cultures were pulsed 8 h before harvesting with 1 µCi
[3H]TdR (40 Ci/nmol; Radiochemical Center, Amersham Pharmacia Biotech), and incorporation of [3H]TdR was measured by
liquid scintillation spectrometry. Helper T cell responses were
tested by immunizing mice (three per group) with 100 µg of NIP-OVA in CFA in the tail base. For control, mice received PBS in
CFA (referred to as CFA only in Fig. 3). After 14 d, sera from immunized mice were pooled and tested for the presence of anti-NIP
IgG by ELISA as described (15). Plates coated with 5 µg/ml of
NIP-BSA and then blocked with PBS/1% BSA received dilutions
of the sera. Binding of the anti-NIP IgGs was revealed by alkaline
phosphatase-conjugated goat anti-mouse IgG (Southern Biotechnology Associates). Allogeneic killer cells were generated as described previously (8). In brief, 107 responders (H-2b splenocytes
from wild-type TCR-
or mutant TCR-
transgenic mice) were
cultured with 107 x-irradiated stimulators (H-2d splenocytes from
BALB/c mice). After 5 d, various numbers of responder cells
(numbers used to calculate the E/T ratios) were cultured with 104
Na251CrO4-labeled target LPS blasts. After 4 h, supernatant was
harvested. Some wells contained only labeled targets with or without 0.01 M HCl/10% SDS containing medium to determine maximum and spontaneous release, respectively. Data are presented as
percentage of killing = [(experimental release
spontaneous release)/(total release
spontaneous release)] × 100.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 3.
Functional analysis of peripheral T cells from syngeneic control mice
(WT), wild-type TCR- ( ), or mutant
TCR- ( -loop ) transgenic mice. Proliferative response to SEB (A) or SEC 2 (B)
superantigens after 48 h of culture. Helper
T cell responses (C) assessed 14 d after immunization with NIP-OVA/CFA. Sera
from the immunized mice were tested for
the presence of anti-NIP IgGs by ELISA on
plates coated with NIP-BSA. (D) Allogeneic killer assay. Splenocytes from H-2b
control or transgenic mice were stimulated
for 5 d with allogeneic H-2d BALB/c cells.
Cytotoxic function was then tested on syngeneic H-2b (open symbols) or allogeneic
H-2d (filled symbols) Na251CrO4-labeled
target LPS blasts.
|
|
 |
Results and Discussion |
Surface Expression of TCR Containing the Mutant, FG Loop-
deleted
Chain.
To test whether the deletion of the complete 14-amino acid FG loop in the C
domain would be
deleterious for the TCR assembly and surface expression,
we transfected TCR
T cell thymoma 58 with retroviral
vectors coding for either a control or a mutant
chain together with a wild-type
chain (10). To our initial surprise, the TCR surface expression was only slightly lower
in the mutant case (Fig. 1 A). However, we must point out
that the observed 30-50% reduction in the surface expression represents a handicap in the TCR assembly which, although small, is real since we have used a very efficient retroviral transfection system that allows us to create bulk
transformants containing thousands of individual clones and
which, therefore, provides us with a reliable statistical average. Functional analyses of these transfectomas consistently
showed that the cells transfected with the mutant TCR
chain responded slightly less (about threefold) to antigenic
stimulation as exemplified here by the dose-response curves
to influenza hemagglutinin peptide HA 110-119 (Fig. 1 B) or SEC 3 superantigen (Fig. 1 C).

View larger version (21K):
[in this window]
[in a new window]

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 1.
The mutant TCR chain is functionally expressed on the cell surface. (A) Cells transfected with TCR chain together with a control ( ) or mutant chain ( -loop ) were stained with biotinylated anti-CD3 mAb followed by streptavidin-APC. Staining of cells transfected with mutant chain only is shown as negative control. Numbers represent the mean of fluorescence intensity of CD3 staining. (B and C) Functional response of
105 TCR transfectants ( , ;  -loop , ) cultured with 105 irradiated antigen-presenting cells (B cell lymphomas A20) and the indicated concentrations of influenza hemagglutinin peptide HA 110-119 (B) or superantigen SEC 3 (C). After 20 h, the culture supernatant was collected and tested for the
presence of lymphokines using the IL-2-dependent proliferation assay of HT2 cell lines.
|
|
Derivation of TCR
Chain Transgenic Mice.
To more rigorously assess the functional potential of the TCR containing the mutant
chain in normal physiological settings in
vivo, we generated transgenic mice expressing either a
wild-type or a loop-deleted version of the TCR
chain.
The
transgenes, as in the above transfection studies, were
derived from 14.3d T cell hybridoma expressing the TCR
specific for influenza hemagglutinin peptide HA 110-119 in the context of I-Ed MHC class II molecules (16). In fact,
it was the very same
chain (V
8.2-J
2.1) whose three-dimensional structure was first solved, thus providing us
with the inspiration for the current study (3). Two characteristics of the transgenic lines used here were considered
essential for straightforward interpretation of the data. First,
the level of
/
TCR expression was identical in both
lines (Fig. 2). Presumably the small handicap of the mutant
chain in the TCR assembly could be compensated by
higher intracellular expression. Second, both transgenes
were bred to TCR-
/
background to avoid any contribution of endogenous
chains for the observed
/
T cell
behavior (11).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 2.
FACScanTM analysis of thymocytes or lymph node cells from
mutant TCR chain transgenic mice. Thymocytes from littermate control (A and B), wild-type TCR- (C and D), or mutant TCR- (E and
F) transgenic mice were triple-stained with anti-CD8-Cy5, anti-CD4-
PE, and anti-V 8 (F23.1-FLUOS) antibodies. Numbers in all dot plots
are percentages of total cells. Histograms represent V 8 expression of
gated single positive CD4+ thymocytes, and numbers show the mean of
fluorescence intensity of V 8 staining. Lymph node cells from wild-type
TCR- (G) or mutant TCR- (H) transgenic mice were stained with
anti-C -FITC and anti-CD4-PE.
|
|
Mutant TCR
Chain Supports Normal
/
T Cell Development.
/
T cell development proceeds undisturbed
and similarly in both TCR
chain transgenic lines as
shown by flow cytometric analysis of thymic and lymph
node cells (Fig. 2). Even the skewing into single positive
CD4 thymocytes, as noted earlier for our wild-type TCR-
transgenic mice (8), occurs to the same extent in both lines.
As predicted, mAb H57-597 (anti-C
[13]) does not bind
to mutant TCR
chain (Fig. 2 H [6]). Interestingly, mAb F23.1 (anti-V
8.1, 2, 3 [14]) binds equally well to both
chains, whereas mAb MR5-2 (anti-V
8.1, 2 [17]) fails to
react with the mutant, suggesting that the FG loop may
form part of the MR5-2 epitope (not shown). Since the
cellularity of thymi is normal in both cases, we assume that
pre-TCR-mediated T cell expansion occurs normally in
these mice.
Normal
/
T Cell Responses in Mutant
Chain Transgenic
Mice.
Peripheral T cell responses were measured in several types of assays, and none of them, to our disappointment, showed any significant differences between mice of
the different transgenic lines. The in vitro responses to anti-TCR antibodies (not shown) and to SEC 2 and SEB superantigens were repeatedly similar in all mice tested (Fig. 3,
A and B). In addition, the in vivo CD4+ T cell responses
measured by T cell help for hapten-specific IgG production
were basically indistinguishable between control and mutant mice (Fig. 3 C). Finally,
/
T cells from mutant TCR
chain transgenic mice made as vigorous cytotoxic T cell
responses against allogeneic targets as their control counterparts (Fig. 3 D). We also monitored the representation of
four different V
families by flow cytometry in peripheral
T cells in order to reveal any subtle in vivo biases, but none
were found (Table I). In addition, limited DNA sequence
analyses of V
2 and 8 families from single
/
T cells
revealed no obvious "mutant"-specific features (data not
shown).
Concluding Remarks.
Thus far, we have found only a
quantitative role in the TCR assembly process for the large
solvent-exposed FG loop on the C
domain. In transfectants, the TCR will assemble in the absence of the loop in
the
chain but slightly less efficiently compared with the
wild-type structure. Of course, the reduced surface expression leads to somewhat impaired function. However, we
were able to show in vivo that TCRs are functionally expressed at the same level with or without the FG loop, and
we did not find any qualitative or quantitative differences
in their activity. This finding seems to rule out the models
where the FG loop has an absolute role in TCR signaling.
However, the apparent absence of any effect in vivo could
also be due to the fact that some subtle compensatory mechanisms have been turned on in vivo (but not in cell
lines), e.g., TCR affinities could be modulated, or new carbohydrate structures on the C
domain could partially replace the FG loop functionally. Interestingly, all nonmammalian species studied to date, including birds, amphibians,
reptiles, and fish, do not have the FG loop on their C
domain (18); hence, our in vivo findings may not be that surprising.
Address correspondence to Sylvie Degermann or Klaus Karjalainen, Basel Institute for Immunology, Grenzacherstrasse 487, CH-4005 Basel, Switzerland. Phone: 41-61-605-1249; Fax: 41-61-605-1364; E-mail:
degermann{at}bii.ch, or karjalainen{at}bii.ch
Received for publication 30 November 1998 and in revised form 21 January 1999.
The Basel Institute for Immunology was founded and is supported by F. Hoffmann-La Roche Ltd., Basel,
| 1.
|
Klausner, R.D.,
J. Lippincott-Schwartz, and
J.S. Bonifacino.
1990.
The T cell antigen receptor: insights into organelle biology.
Annu. Rev. Cell Biol.
6:
403-431
.
|
| 2.
|
Letourneur, F., and
R. Klausner.
1992.
Activation of T cells
by a tyrosine kinase activation domain in the cytoplasmic tail
of CD3 epsilon.
Science.
255:
79-82
[Abstract/Free Full Text].
|
| 3.
|
Bentley, G.,
G. Boulot,
K. Karjalainen, and
R. Mariuzza.
1995.
Crystal structure of the beta chain of a T cell antigen
receptor.
Science.
267:
1984-1987
[Abstract/Free Full Text].
|
| 4.
|
Garcia, K.,
M. Degano,
R. Stanfield,
A. Brunmark,
M. Jackson,
P. Peterson,
L. Teyton, and
I. Wilson.
1996.
An alphabeta T cell receptor structure at 2.5 Å and its orientation in
the TCR-MHC complex.
Science.
274:
209-219
[Abstract/Free Full Text].
|
| 5.
|
Garboczi, D.,
P. Ghosh,
U. Utz,
Q. Fan,
W. Biddison, and
D. Wiley.
1996.
Structure of the complex between human
T-cell receptor, viral peptide and HLA-A2.
Nature.
384:
134-141
[Medline].
|
| 6.
|
Wang, J.,
K. Lim,
A. Smolyar,
M. Teng,
J. Liu,
A. Tse,
R. Hussey,
Y. Chishti,
C. Thomson,
R. Sweet, et al
.
1998.
Atomic structure of an alphabeta T cell receptor (TCR) heterodimer in complex with an anti-TCR fab fragment derived
from a mitogenic antibody.
EMBO (Eur. Mol. Biol. Organ.) J.
17:
10-26
[Medline].
|
| 7.
|
Ghendler, Y.,
A. Smolyar,
H. Chang, and
E. Reinherz.
1998.
One of the CD3 subunits within a T cell receptor
complex lies in close proximity to the C FG loop.
J. Exp.
Med.
187:
1529-1536
[Abstract/Free Full Text].
|
| 8.
|
Kirberg, J.,
A. Baron,
S. Jakob,
A. Rolink,
K. Karjalainen, and
H. von Boehmer.
1994.
Thymic selection of CD8+ single positive cells with a class II major histocompatibility complex-restricted receptor.
J. Exp. Med.
180:
25-34
[Abstract/Free Full Text].
|
| 9.
|
Markowitz, D.,
S. Goff, and
A. Bank.
1988.
A safe packaging
line for gene transfer: separating viral genes on two different
plasmids.
J. Virol.
62:
1120-1124
[Abstract/Free Full Text].
|
| 10.
|
Backstrom, B.,
E. Milia,
A. Peter,
B. Jaureguiberry,
C. Baldari, and
E. Palmer.
1996.
A motif within the T cell receptor
alpha chain constant region connecting peptide domain controls antigen responsiveness.
Immunity.
5:
437-447
[Medline].
|
| 11.
|
Mombaerts, P.,
A. Clarke,
M. Rudnicki,
J. Iacomini,
S. Itohara,
J. Lafaille,
L. Wang,
Y. Ichikawa,
R. Jaenisch,
M. Hooper, et al
.
1992.
Mutations in T-cell antigen receptor
genes alpha and beta block thymocyte development at different stages [published erratum at 360:491].
Nature.
360:
225-231
[Medline].
|
| 12.
|
Degermann, S.,
C. Surh,
L. Glimcher,
J. Sprent, and
D. Lo.
1994.
B7 expression on thymic medullary epithelium correlates with epithelium-mediated deletion of V beta 5+ thymocytes.
J. Immunol.
152:
3254-3263
[Abstract].
|
| 13.
|
Kubo, R.,
W. Born,
J. Kappler,
P. Marrack, and
M. Pigeon.
1989.
Characterization of a monoclonal antibody which detects all murine  T cell receptors.
J. Immunol.
142:
2736-2742
[Abstract].
|
| 14.
|
Staerz, U.,
H. Rammensee,
J. Benedetto, and
M. Bevan.
1985.
Characterization of a murine monoclonal antibody
specific for an allotypic determinant on T cell antigen receptor.
J. Immunol.
134:
3994-3999
[Abstract].
|
| 15.
|
Andersson, J.,
F. Melchers, and
A. Rolink.
1995.
Stimulation
by T cell independent antigens can relieve the arrest of differentiation of immature auto-reactive B cells in the bone marrow.
Scand. J. Immunol.
42:
21-33
[Medline].
|
| 16.
|
Weber, S.,
A. Traunecker,
F. Oliveri,
W. Gerhard, and
K. Karjalainen.
1992.
Specific low-affinity recognition of major
histocompatibility complex plus peptide by soluble T-cell receptor.
Nature.
356:
793-796
[Medline].
|
| 17.
|
Kanagawa, O..
1988.
Antibody-mediated activation of T cell
clones as a method for screening hybridomas producing antibodies to the T cell receptor.
J. Immunol. Methods.
110:
169-178
[Medline].
|
| 18.
|
Chretien, I.,
A. Marcuz,
J. Fellah,
J. Charlemagne, and
L. Du
Pasquier.
1997.
The T cell receptor genes of Xenopus.
Eur.
J. Immunol.
27:
763-771
[Medline].
|