|
|
|
|
|
|
|
||
B in Promoting
Double Positive Thymocyte Apoptosis
By
From the * Departments of Medicine and Pathology, University of Chicago, Chicago, Illinois 60637;
and the Department of Pharmacology, University of California San Diego, San Diego,
California 92093
 |
Abstract |
|---|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
To examine the role of nuclear factor (NF)-
B in T cell development and activation in vivo,
we produced transgenic mice that express a superinhibitory mutant form of inhibitor B-
(IB-A32/36) under the control of the T cell-specific CD2 promoter and enhancer (mutant
[m]IB- mice). Thymocyte development proceeded normally in the mIB- mice. However, the numbers of peripheral CD8+ T cells were significantly reduced in these animals. The
mIB- thymocytes displayed a marked proliferative defect and significant reductions in interleukin (IL)-2, IL-3, and granulocyte/macrophage colony-stimulating factor production after
cross-linking of the T cell antigen receptor. Perhaps more unexpectedly, double positive (CD4+CD8+; DP) thymocytes from the mIB- mice were resistant to -CD3-mediated apoptosis in vivo. In contrast, they remained sensitive to apoptosis induced by 
-irradiation. Apoptosis of wild-type DP thymocytes after in vivo administration of -CD3 mAb was preceded
by a significant reduction in the level of expression of the antiapoptotic gene, bcl-xL. In contrast, the DP mIB- thymocytes maintained high level expression of bcl-xL after -CD3 treatment. Taken together, these results demonstrated important roles for NF-B in both inducible cytokine expression and T cell proliferation after TCR engagement. In addition, NF-B is required for the -CD3-mediated apoptosis of DP thymocytes through a pathway that involves
the regulation of the antiapoptotic gene, bcl-xL.
B;
inhibitor B-A32/36;
thymocytes;
apoptosis;
bcl-xL
| |
Introduction |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
The mammalian nuclear factor (NF)-B1 transcription
factors, NF-B1 (p50/p105), NF-B2 (p52/p100),
RelA (p65), c-Rel, and RelB are involved in the regulation of immune and inflammatory responses, cellular proliferation, and cell death (for review see references 1). NF-B proteins modulate these diverse biological processes by
regulating the expression of a wide variety of genes encoding cytokines and cytokine receptors, chemokines, cell
adhesion molecules, cell-surface receptors, hematopoietic
growth factors, acute phase proteins, and other transcription factors. Transcriptional activation or repression of NF-B target genes requires binding of NF-B dimers to B
DNA binding sites. Although p50/p65 heterodimers are
considered the prototypical NF-B dimer, many different
combinations of NF-B homo- and heterodimers exist (5)
and there is evidence to suggest that these different NF-B
dimers regulate the expression of different genes (6).
In most cells, the transcriptional activity of NF-B proteins is controlled at the posttranslational level by regulated
associations with members of the inhibitor (I)B family of
inhibitory proteins. NF-B proteins are retained in the cytoplasm of unstimulated cells and thus rendered inactive via
interactions with one or more of the seven known IB
proteins: IB-, IB-
, IB-, Bcl-3, IB-
, p105, and
p100 (3, 7). In response to a wide variety of stimuli, including antigen receptor cross-linking, and exposure to cytokines (TNF-, IL-1), bacterial components (LPS), viruses, ionizing radiation, or oxidative stress, IB- and - proteins are phosphorylated and degraded and cytoplasmic
NF-B dimers released from their inhibitory proteins are
rapidly translocated to the nucleus where they regulate the
transcription of genes containing B binding sites (8).
Recent studies have demonstrated that phosphorylation of
Ser32 and Ser36 and subsequent polyubiquitination of IB-
are essential for the release and nuclear translocation of NF-B dimers (12). Substitution of IB- Ser32 and Ser36 by Ala residues prevents phosphorylation and degradation
of IB-, thereby retaining NF-B dimers in an inactive
form in the cytoplasm.
NF-B proteins are thought to play important roles in T
cell activation and development (19, 20). Functionally important B binding sites have been identified in a large
number of T cell transcriptional regulatory elements, including the IL-2, IL-2R, G-CSF, and macrophage inflammatory protein (MIP)-2 promoters (1). Preformed
NF-B proteins are present in the cytoplasm of thymocytes and resting peripheral T cells (21). TCR engagement results in the rapid phosphorylation of IB- and the concomitant nuclear migration of active NF-B dimers (19,
22, 23). Despite these findings, it has been difficult to precisely elucidate the role of NF-B in regulating T cell development, activation, and apoptosis in vivo. During the
last several years, gene targeting experiments have demonstrated that RelB, c-Rel, and NF-B1 each play important but distinct roles in regulating the development and function of the mammalian immune system. NF-B1-deficient
mice displayed defects in B cell proliferation in response to
the mitogen LPS but not to IgM cross-linking (24, 25).
RelB is required for the differentiation and/or survival of
dendritic cells and thymic medullary epithelial cells and
RelB
/ mice displayed severely defective cellular immune responses (26, 27). The immune dysfunction observed in RelB/ mice was worsened in NF-B1/RelB
double knockout mice, suggesting that the lack of RelB is
compensated for by other NF-B1-containing dimers (28).
c-Rel-deficient mice displayed defective B and T cell proliferation in response to mitogen stimulation as well as
markedly decreased IL-2 production after TCR engagement (29). In contrast, mice lacking RelA died on embryonic day 15 from massive hepatocyte apoptosis (30, 31).
However, progenitor cells derived from RelA/ mice
were able to give rise to normal T cells, suggesting that RelA is not required for T cell development (30, 32).
Recent studies have suggested that, in addition to regulating lymphocyte function, NF-B proteins might play a
critical role in protecting cells against apoptosis. Support for
this model came both from the finding of hepatocyte apoptosis in the RelA/ mice and from experiments demonstrating that overexpression of a dominant-negative form of
the IB- protein in transgenic mice (33) and several cell
lines promoted apoptosis in vitro (34). However, other
studies have suggested that NF-B can also function in a
proapoptotic fashion. For example, induction of apoptosis in 293 cells after serum withdrawal requires RelA activation (40). Similarly, radiation-induced apoptosis in ataxia
telangiectasia cells is suppressed by dominant-negative
IB- proteins (41) and inhibition of NF-B activation
prevents apoptosis in cultured human thymocytes (42). Finally, NF-B activation promotes apoptosis in neural cells
(43) and T cell hybridomas (44), and high levels of c-Rel
induce apoptosis in avian embryos and in bone marrow
cells in vitro (45).
Although gene targeting experiments have been useful
for identifying the essential nonredundant roles of individual NF-B transcription factors in T cell development and
function, the interpretation of these experiments can be
obscured by functional redundancies of related gene products in the mutant animals and by embryonic lethal phenotypes that preclude a complete analysis of lymphoid development and function. Moreover, in some cases it can be
difficult to distinguish cell autonomous and non-cell autonomous phenotypes because mutant animals lack expression of the targeted gene in all cell lineages. We and others
(33, 46) have used a complementary approach that circumvents these potential problems to study the role of NF-B
in T cell development, activation, and apoptosis in vivo.
Specifically, we have generated transgenic mice that express
a mutant superinhibitory form of the IB- protein under
the control of the T cell-specific CD2 promoter and enhancer. This superinhibitory form of IB- cannot be
phosphorylated on Ser32 and Ser36 and degraded in response
to TCR cross-linking and would therefore be expected to
constitutively inhibit the nuclear translocation of NF-B
proteins after T cell activation. Studies of the mIB- mice
revealed several important functions for NF-B in T cells
in vivo. First, NF-B is required to develop or maintain
normal numbers of peripheral CD8+ T cells. Second,
NF-B activation is necessary for both cytokine production and thymocyte proliferation after TCR engagement.
Finally and somewhat unexpectedly, NF-B is required for
-CD3-mediated apoptosis of double positive (DP) thymocytes in vivo via a pathway that involves downregulated
expression of the antiapoptotic gene bcl-xL in DP thymocytes.
| |
Materials and Methods |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Transgene Construction and Generation of Transgenic Mice.
The construction of the hemagglutinin (HA)-tagged IB- cDNA
with Ser to Ala substitutions at positions 32 and 36 has been described previously (47). The mutant IB- cDNA was inserted into the XhoI site of pTEx (provided by Dr. M. Owen, Imperial Cancer Research Fund, London, UK), which contains the promoter, polyadenylation site, and locus control region elements
from the human CD2 gene (48). Transgene DNA was microinjected into the male pronucleus of fertilized single cell embryos of
CD1 mice. Microinjected eggs were transferred to pseudopregnant
CD1 foster mothers. EcoRI-digested tail DNA from 12-14-d-old
pups was hybridized to a radiolabeled 0.8-kb IB--specific
probe, and the transgene copy number was determined using a
PhosphorImager (Molecular Dynamics).
Cell Culture.
Single cell suspensions of thymocytes and splenocytes were cultured at 37°C, 5% CO2 in RPMI 1640 medium containing 10% heat inactivated FCS, 100 U/ml penicillin/streptomycin, 2 mM glutamine, 0.1 mM nonessential amino acids, 5.5 × 102 µM-ME (all from GIBCO BRL). Thymocyte proliferation
assays were performed in 96-well plates (Becton Dickinson) that
had been coated overnight with -CD3 mAb (145-2C11;
PharMingen) and/or -CD28 mAb (37.51; PharMingen) at a
concentration of 16 µg/ml. Stimulation with PMA (Sigma
Chemical Co.) and ionomycin (Calbiochem) was performed at 5 ng/ml and 0.25 µg/ml, respectively. After stimulation for 48 h,
cells (0.5 × 106/ml) were pulsed for 18 h at 37°C with [3H]thymidine (1 µCi/ml; Amersham). Cells were transferred onto glass
fiber filter mats and radioactive incorporation was measured with
a beta scintillation counter.
Fetal Thymic Organ Culture.
Fetuses of CD1 and mIB-
mice were obtained at embryonic day 17.5 of pregnancy, counting the day of vaginal plug as embryonic day 1. Equally sized thymic lobes were cultured in 24-well Transwell dishes (Costar
Corp.) containing complete DMEM-10 medium. The samples
were maintained in an atmosphere of 5% CO2 for 72 h and treated with -CD3 mAb (145-2C11) as described in the text.
ELISA Assays.
For ELISA assays, 96-well plates (Dynatech Labs.) were coated overnight at 4°C with-IL-2 (JES6-1A12),
-IL-3 (MP2-8F8), or -GM-CSF (MP1-22E9) mAbs (PharMingen). Serial dilutions of supernatants from thymocytes stimulated in culture for 48 h were added to the antibody-coated plates
and incubated for 18 h at 4°C. Biotinylated antibodies against
IL-2 (JES5-5H4), IL-3 (MP2-43D11), or GM-CSF (MP1-31G6)
were then added to the plates and incubated for 2 h at room temperature. Avidin peroxidase (Sigma Chemical Co.) and ABTS (3-ethylbenzthiazoline-6-sulfonic acid) were added to the wells and
enzymatic reactions were quantitated in a microplate reader (Dynatech Labs.). All samples were assayed in triplicate.
Western Blot Analysis.
Cytoplasmic and nuclear thymocyte extracts were prepared as previously described (49). In brief, thymocytes were washed with PBS, incubated in buffer A (10 mM Hepes, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, and 0.2 mM phenylmethylsulfonyl fluoride) for 10 min at 4°C and centrifuged to separate nuclei (pellet) from cytoplasmic proteins (supernatant). Nuclei were lysed by incubation with buffer C (20 mM Hepes, pH 7.9, 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 10 mg/ml aprotinin, and 10 mg/ml leupeptin) at 4°C and lysates were cleared by centrifugation. Nuclear and cytoplasmic extracts were frozen at
70°C. Protein concentrations were determined using a commercially available kit (Bio-Rad). For Western blot analysis, 15 µg of cytoplasmic extracts were fractionated by SDS-PAGE in 10% polyacrylamide
gels and transferred to PVDF membranes (Millipore). Western
blots were probed with a rabbit polyclonal antibody against
MAD-3 (1:2,000 dilution; nomenclature of DiDonato et al. [reference 13], No. 644) or an -HA-specific antibody (1:2,000
dilution; 12CA5). Blots were developed with goat -rabbit
(1:2,000 dilution; Amersham) or rat -mouse (1:5,000 dilution;
Kirkegaard and Perry Labs.) secondary antibodies and a commercially available chemiluminescence kit according to the manufacturer's instructions (Pierce Chemical Co.).
Electrophoretic Mobility Shift Assay.
A double-stranded oligonucleotide, spanning theB site of the IL-2R promoter (50)
(5' GGAACGGCAGGGGAATTCCCCTCTCCTT 3') was labeled with 32P-nucleotides using the Klenow fragment of DNA
polymerase I. Binding reactions contained 2 µg nuclear extract,
20,000 disintegrations per min (0.1-0.5 ng) of radiolabeled oligonucleotide probe, 2 µg poly (dI-dC) in 75 mM KCl, 10 mM
Tris, pH 7.5, 1 mM dithiothreitol, 1 mM EDTA, and 4% (vol/
vol) Ficoll in a final volume of 20 µl. After incubation on ice for
30 min, DNA protein complexes were fractionated by electrophoresis in nondenaturing 4% polyacrylamide gels at 120 V for
2.5 h in running buffer (25 mM Tris, 25 mM Boric acid, and 0.5 mM EDTA) with 47 µM -ME. For competition experiments, 50 ng of unlabeled NF-B oligonucleotide was added to the
binding reaction before addition of the radiolabeled oligonucleotide probe. For antibody supershift experiments, the nuclear extracts were incubated with 1 µl of -p50 (F056), -RelB (A277),
-p65 (B127), or -c-Rel (L036) antibodies (all from Santa Cruz
Biotechnology) before starting the binding reactions.
Flow Cytometry.
Single cell suspensions of lymphocytes (106 cells) were washed in PBS and incubated with PE--CD4
(RM4-5), FITC--CD8 (53-6.7), FITC--CD3 (145-2C11),
and/or PE--TCR-/ (H57-97) mAbs (PharMingen) in PBS
plus 0.1% BSA for 30 min on ice. After staining, the cells were
washed in PBS and analyzed on a FACScan® (Becton Dickinson).
Each plot represents analysis of >104 events using WinMDI software (Windows Multiple Document Interface, version 2.5). For intracellular staining, 106 thymocytes were stained with Cy-Chrome-
-CD4 (RM4-5) and PE--CD8 (53-6.7), and fixed in 4%
paraformaldehyde. Fixed thymocytes were washed with 0.03%
saponin (Sigma Chemical Co.) and incubated with 100 µl 0.3%
saponin, 20 µl blocking serum (Sigma Chemical Co.) and FITC-
-Bcl-xL (7B2.5) (Southern Biotechnology Associates). After 30 min of incubation at 4°C, cells were washed twice in 0.03% saponin
followed by one wash in FACS buffer before FACScan® analysis.
Ribonuclease Protection Assays.
Ribonuclease protection assays were performed using a commercially available kit as described by the manufacturer (PharMingen) using the mAPO-2 multiprobe template set, 10 µg thymic RNA, and 0.1 mCi-[32P]UTP
(Amersham). RNAse-protected fragments were resolved by electrophoresis in polyacrylamide gels and visualized by autoradiography (Eastman Kodak Co.).
TUNEL Assays.
TUNEL (Tdt-mediated dUTP nick end labeling) assays were performed on paraffin-embedded sections of thymi according to Gavrieli et al. (51). Photomicrographs were obtained with a Zeiss Axioskop.| |
Results |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
B- Transgenic Mice.
To inhibit inducible NF-B activity in thymocytes in vivo, we produced
transgenic mice that expressed a "superinhibitory" form of
IB- under the control of the T cell-specific CD2 promoter and enhancer (mIB- mice). We chose to use an
IB- transgene because previous studies have demonstrated that IB- plays a critical role in regulating inducible NF-B expression (for review see references 2,
52). The superinhibitory mIB-A32/36 transgene containing
Ser32 and Ser36 to Ala substitutions cannot be phosphorylated and degraded in response to TCR engagement and
would therefore be expected to constituitively inhibit NF-B activity in both resting and activated thymocytes and T
cells. The CD2 promoter and enhancer (48, 53; Fig. 1 A)
were used in these studies because (a) they program T cell-
specific transgene expression and (b) they are expressed at
high levels in all thymocyte subsets including double negative (CD4CD8; DN), DP (CD4+CD8+), and single
positive (CD4+ or CD8+; SP) cells (54). The transgene
construct also contained three copies of an 11-amino acid
influenza virus HA epitope tag (55) that allowed us to distinguish the transgene-encoded protein from endogenous
murine IB-. A line of mIB- mice containing ~12 copies of the transgene was produced by injection of this
construct into fertilized CD1 mouse embryos (Fig. 1 B).
Homozygous transgenic mice were generated by breeding
heterozygous littermates in order to obtain maximal levels
of IB-A32/36 protein expression, an important consideration in producing a dominant-negative phenotype. A second line of transgenic mice expressing the IB-A32/36
cDNA under the control of the proximal lck promoter and
the CD2 enhancer was also produced (data not shown).
Similar phenotypes were observed in both lines of transgenic mice and are therefore not distinguished in the results
described below.
|
Endogenous IB- is phosphorylated and degraded after
treatment of T cells with the NF-B inducer, TNF- (47).
To analyze the relative levels of endogenous and transgene-encoded IB- and to study the differential regulation of
the two proteins in response to TNF-, we performed
Western blot analyses using whole cell extracts from mIB-
and control thymocytes that had been treated for different
times with TNF- (Fig. 2 A). Basal levels of the IB-A32/36
protein as detected with both the -HA and -IB-
(-MAD) antibodies slightly exceeded levels of the endogenous IB- protein in the mIB- thymocytes. In both
wild-type and mIB- thymocytes, endogenous IB-
was almost completely degraded after 15 min of TNF-
treatment and remained undetectable until ~30 min after
treatment. As previously reported (9, 15), endogenous
IB- was reexpressed between 30 and 60 min after TNF- treatment (data not shown). This reexpression reflects NF-B-mediated activation of the IB- promoter. In marked
contrast, levels of the transgene-encoded IB-A32/36 were
unchanged by TNF- treatment at all time points (Fig. 2
A). Activation of mIB- thymocytes with PMA plus ionomycin or TCR cross-linking resulted in a similar degradation of endogenous IB-, whereas the levels of IB-A32/36 remain unaffected (data not shown).
|
To analyze the effects of IB-A32/36 expression on the
nuclear translocation of NF-B proteins after T cell activation, we performed electrophoretic mobility shift assays
(EMSAs) using nuclear extracts prepared from both resting
thymocytes and thymocytes activated in vivo by intraperitoneal injection of an -CD3 mAb (Fig. 2 B). As reported
previously, nuclear extracts from unstimulated wild-type
and mIB- thymocytes both contained p50 homodimers that bound to the radiolabeled B probe (22, 56). The
presence of such p50 homodimers in uninduced thymic
nuclear extracts probably reflected the fact that p50 binds to
IB proteins with lower affinity and therefore is not quantitatively retained in the cytoplasm of either wild-type or
mIB- thymocytes (57). Because p50 homodimers do
not contain a transcriptional activation domain they are
thought to repress B-dependent gene expression (58).
After activation with -CD3 mAb, the level of p50
homodimers increased equivalently in the wild-type and
mIB- thymocyte nuclear extracts. In addition, an inducible low mobility B binding complex appeared in the
nuclear extracts of wild-type thymocytes. Antibody supershift experiments demonstrated that this complex contained
predominantly p50/p65 heterodimers as well as smaller
amounts of c-Rel- and RelB-containing heterodimers
(Fig. 2 B). The induction of this low mobility B binding
activity was markedly inhibited after -CD3-mediated activation of the mIB- thymocytes (Fig. 2 B). Taken together, these Western blotting and EMSA experiments
demonstrated that thymocytes from the mIB- transgenic
animals expressed high levels of cytoplasmic IB-A32/36
protein that was not degraded after TCR engagement in
vivo. Moreover, constitutive expression of the IB-A32/36 protein significantly reduced the induction of nuclear p50/
p65, c-Rel/p50, and RelB/p50 NF-B heterodimers after either TNF- or -CD3-mediated activation of the
mIB- thymocytes.
B- Transgenic
Mice.
To investigate T cell development in the mIB-
mice, thymocytes and peripheral T cells from transgenic
and wild-type animals were analyzed by flow cytometry
using antibodies specific for a variety of developmentally
regulated T cell surface antigens (Fig. 3). Thymi from the
mIB- animals contained normal populations of DN, DP,
and SP cells. Levels of CD3 and TCR-/ expression were
also indistinguishable on wild-type and mIB- thymocytes (Fig. 3 B), as were expression of TCR-/
and
heat-shock antigen (data not shown). Thus, expression of
IB-A32/36 did not appear to perturb thymocyte ontogeny.
Total numbers of SP peripheral T cells in both the spleen
and the lymph nodes were normal in mIB- mice as were
the numbers of splenic CD4+ T cells. However, as described previously by Boothby at al. and Esslinger et al. (33,
46), the numbers of peripheral CD8+ T cells were reduced
by ~50% in mIB- mice (Fig. 3 C).
|
B-
Transgenic Thymocytes.
To assess the effects of IB-A32/36
expression on cytokine production and proliferation, thymocytes from mIB- and wild-type control littermates were activated in vitro for 72 h with PMA plus ionomycin, -CD3
mAb, or -CD3 plus -CD28 mAbs. When compared with
wild-type thymocytes, proliferation of the mIB- thymocytes was reduced by 63% in response to PMA plus ionomycin and by 78% after activation with -CD3 mAb (Fig. 4).
Previous studies have suggested that CD28 costimulation may
function, at least in part, through an NF-B-dependent pathway (59). Therefore, we tested the ability of CD28 costimulation to rescue the defect in -CD3-mediated thymocyte proliferation seen in the mIB- thymocytes. Interestingly, the
observed reductions in thymocyte proliferation were partially, but not completely, rescued by -CD28 costimulation (Fig.
4). Thus, the CD28 signaling pathway can at least partially
bypass the requirement for NF-B activation in thymocyte
activation by TCR engagement.
|
Many cytokine genes including IL-2, IL-3, and GM-CSF are potential targets for NF-B (60). However, the
role of NF-B in regulating activation-specific cytokine
expression in vivo, particularly the expression of the IL-2
gene, remains controversial. Therefore, we compared cytokine production by the wild-type and mIB- thymocytes after activation with -CD3 plus -CD28 mAbs
(Fig. 5). As compared with wild-type thymocytes, the
mIB- thymocytes displayed significantly decreased production of IL-2, IL-3, and GM-CSF after -CD3 plus -CD28 activation (Fig. 5). IL-2 production was most
significantly reduced (28% of wild-type levels), whereas
GM-CSF and IL-3 production were less dramatically inhibited (Fig. 5). Taken together, these experiments demonstrated that NF-B is required both for the induction of
multiple cytokines and for normal thymocyte proliferation
after TCR cross-linking.
|
B-A32/36 Thymocytes Are Protected against -CD3-
mediated Apoptosis In Vivo.
Systemic administration of -CD3
mAb has been shown to result in the rapid depletion of
>90% of DP thymocytes by apoptosis (61). NF-B positively regulates the expression of death-rescuing genes,
thereby preventing TNF--induced apoptosis at least in certain cell types (34). Based upon these findings, it was reasonable to hypothesize that DP thymocytes from the mIB-
mice that failed to activate NF-B normally would display
increased apoptosis after systemic administration of -CD3
mAb. To directly test the role of NF-B in mediating
the -CD3-mediated apoptotic death of DP thymocytes,
mIB- and wild-type animals were injected intraperitoneally with -CD3 mAb and thymocyte subsets were assessed by flow cytometry 48 h after injection. As shown in
Fig. 6 and consistent with previous reports (62, 63), treatment of wild-type animals with -CD3 mAb resulted in
dose-dependent reductions in the size of the DP thymocyte
population. Wild-type animals treated with 40 µg of -CD3
mAb displayed a 98% reduction in DP thymocytes within
48 h after -CD3 administration. Somewhat surprisingly, this
-CD3-mediated loss of DP thymocytes was completely
and reproducibly prevented in the mIB- mice even after
administration of 40 µg of -CD3 mAb (Fig. 6). Similar reductions in DP thymocyte apoptosis were observed at both
24 and 48 h after injection and after administration of either
20 or 40 µg of -CD3 mAb (Fig. 6 and data not shown).
|
To confirm the protective effects of IB-A32/36 expression on DP thymocyte apoptosis in vivo, we performed
TUNEL assays on thymi from wild-type and mIB- mice
after intraperitoneal injection of -CD3 mAb (Fig. 7).
Large numbers of apoptotic cells were seen in wild-type
thymi after treatment with -CD3 mAb as compared with
littermates treated with an isotype-matched control antibody. In contrast, the frequency of apoptotic cells in the
mIB- thymi was dramatically reduced as compared with
that observed in wild-type thymi after treatment with similar amounts of -CD3 mAb (Fig. 7).
|
B-A32/36 Thymocytes Remain Sensitive to Irradiation-induced Apoptosis In Vivo.
Like -CD3 treatment, irradiation of the thymus is known to cause DP thymocyte
apoptosis in vivo (64). However, recent studies have suggested that these different apoptotic stimuli may use distinct
signaling pathways to regulate programmed cell death.
Given the resistance of mIB- DP thymocytes to
-CD3-mediated apoptosis, it was of interest to determine
the sensitivity of these cells to irradiation in vivo. As
shown in Fig. 6 C, DP thymocytes from the mIB- mice
remained fully sensitive to irradiation-induced apoptosis
in vivo. Thus, expression of the IB-A32/36 transgene protected DP thymocytes from apoptosis in response to -CD3
but failed to protect these cells against irradiation-
induced cell death.
B- Thymocytes Are Resistant to -CD3-mediated
Apoptosis in Fetal Thymic Organ Culture.
The administration
of -CD3 mAbs to mice in vivo can effect thymocytes either
directly or indirectly via the activation of peripheral blood
CD3+ T cells. To attempt to distinguish these possibilities, we
tested the susceptibility of mIB- thymocytes to -CD3-
mediated apoptosis in fetal thymic organ culture (FTOC)
(Fig. 8). Wild-type thymocytes were killed efficiently by 3 d
of FTOC treatment with an -CD3 mAb. In contrast, DP
thymocytes from the mIB- mice were relatively resistant
to -CD3-mediated killing in FTOC. These results suggested that at least some of the resistance to -CD3-mediated DP
thymocyte apoptosis seen in the mIB- mice reflects a
thymus-specific effect of transgene expression.
|
B- Thymocytes Fail To Downregulate Bcl-xL after
-CD3 Treatment In Vivo
The Bcl-2 family of proteins is
comprised of multiple members that function either as
death agonists (Bax, Bak, Bcl-XS, and Bad) or death antagonists (Bcl-2, Bcl-xL, Bcl-x, Mcl-1, A1, and Bcl-w) (65).
Two antiapoptotic members of this family, Bcl-xL and Bcl-2,
are expressed in a reciprocal pattern during thymocyte development. Bcl-2 is expressed at high levels in immature
DN thymocytes. Its expression is downregulated in DP
cells and it is then reexpressed as these DP cells mature to
SP thymocytes and peripheral T cells (66, 67). Conversely,
Bcl-xL is expressed at low or undetectable levels in immature DN cells. Its expression is significantly upregulated in
DP thymocytes, and it is then downregulated as these cells
progress to the SP stage of thymocyte ontogeny (68, 69).
Interestingly, DP thymocytes from transgenic mice that
overexpress Bcl-2 or Bcl-xL are protected from multiple proapoptotic stimuli, including -CD3 treatment in vivo
(69, 70). Given these findings, it was logical to postulate
that altered expression of Bcl-2-family genes in the mIB-
thymocytes might account for their decreased susceptibility
to proapoptotic stimuli. Accordingly, we used an RNAse
protection assay to directly monitor the expression of Bcl-2-related genes in thymocytes from wild-type and mIB-
transgenic mice. As shown in Fig. 9 A, both basal and
-CD3-treated levels of bfl-1, bak, bax, bcl-2, and bad
mRNAs were equivalent in wild-type and mIB- thymocytes. Similarly, we failed to detect differential expression
of mRNAs encoding Fas, Fas-L, TRAF, TRADD, Fadd,
RIP, and FLICE in either unstimulated or -CD3-treated
wild-type and mIB- thymocytes (data not shown). Basal
levels of bcl-xL were equivalent in wild-type and mIB-
thymocytes. However, after -CD3 treatment, the expression of bcl-xL was significantly decreased in the wild-type
cells but was maintained at pretreatment levels in the
mIB- thymocytes (Fig. 9 A).
|
Because Bcl-xL is the predominant antiapoptotic protein
expressed in DP thymocytes, the preferential loss of Bcl-xL
from wild-type thymocytes after -CD3 administration
might have simply reflected the death of these DP cells. To
confirm that the pattern of Bcl-xL protein expression paralleled that of the mRNA and to assess the possibility that the
observed changes in bcl-xL mRNA expression reflected the
preferential death of the DP thymocytes in the wild-type animals, we performed Western blot analyses on thymocyte
extracts 18 and 39 h after -CD3 treatment in vivo. As
shown in Fig. 9 B, levels of Bcl-xL protein were significantly reduced in wild-type thymocytes at both 18 and
39 h after administration of -CD3 mAb. In contrast, levels
of Bcl-xL protein were maintained at unstimulated levels in
the mIB- thymocytes at both time points. Because there is not a significant loss of DP thymocytes 18 h after -CD3
treatment, these results indicated that the loss of Bcl-xL
protein precedes thymocyte apoptosis and is prevented in
the mIB- DP thymocytes. We confirmed this result by
performing intracellular staining of viable DP thymocytes
using Bcl-xL-specific antibodies (Fig. 9 C). 24 h after
-CD3 administration, viable DP thymocytes displayed a
significant decrease in intracellular Bcl-xL as measured by flow cytometry. In contrast, DP thymocytes from the
mIB- mice failed to downregulate intracellular Bcl-xL
expression. In control experiments, SP CD4+ thymocytes
from these same wild-type and mIB- animals both failed
to demonstrate altered levels of intracellular Bcl-xL after -CD3 administration (Fig. 9 D). Taken together, these
results demonstrated that the in vivo administration of
-CD3 mAb resulted in the specific downregulation of the
antiapoptotic gene bcl-xL in DP thymocytes and that this
reduced expression of Bcl-xL was, in turn, associated with
subsequent apoptotic cell death. In contrast, DP thymocytes from mIB- mice failed to downregulate Bcl-xL and were protected from -CD3-mediated programmed cell
death.
| |
Discussion |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
In the studies described in this report, we have used
transgenic mice expressing a superinhibitory form of IB-
to study the function of NF-B in T cells in vivo. The
dominant-negative approach used in these studies circumvents potential problems of functional redundancy and embryonic lethality that can complicate the analysis of gene
targeting experiments. In addition, because the transgene is
only expressed in thymocytes and T cells we can conclude
that the observed defects in T cell function are thymocyte or T cell autonomous. Our results have revealed several
important roles for NF-B proteins in T cell development
and function. First in agreement with previous reports (33,
46) we showed that NF-B is required for the development and/or survival of normal numbers of peripheral
CD8+ T cells, for the inducible expression of multiple cytokine genes, and for normal T cell proliferation in response to TCR-mediated T cell activation. However, our
studies have also revealed an unexpected and novel role for
NF-B proteins in DP thymocyte apoptosis in response to
-CD3 mAb administration in vivo.
B- Mice.
TCR engagement leads to the precisely
orchestrated transcriptional induction of >100 new genes
whose expression together determine the activated T
cell phenotype. Several inducible transcription factors
have been implicated as critical early regulators of activation-specific T cell gene expression. These include NF-AT,
CREB, AP1, and NF-B (60). Three of these, NF-AT,
CREB, and NF-B, are present in an inactive form in resting T cells and are activated by posttranslational phosphorylation or dephosphorylation in response to TCR cross-linking. The precise role of each of these transcription
factors in regulating T cell activation remains unclear because many T cell genes contain binding sites for multiple
inducible transcription factors, and because it has been difficult to extrapolate from the results of transient transfection assays performed in immortalized T cell lines to in
vivo transcriptional regulatory pathways. Thus, fo
).
