The Journal of Experimental Medicine
Avanti Polar Lipids
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 159K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sleckman, B. P.
Right arrow Articles by Alt, F. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sleckman, B. P.
Right arrow Articles by Alt, F. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Exp. Med., Volume 188, Number 8, October 19, 1998 1465-1471

Assembly of Productive T Cell Receptor delta  Variable Region Genes Exhibits Allelic Inclusion

By Barry P. Sleckman, Bernard Khor, Robert Monroe, and Frederick W. Alt

From the Howard Hughes Medical Institute, Children's Hospital and Department of Genetics, Harvard Medical School and The Center for Blood Research, Boston, Massachusetts 02115

    Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The generation of a productive "in-frame" T cell receptor beta  (TCR beta ), immunoglobulin (Ig) heavy (H) or Ig light (L) chain variable region gene can result in the cessation of rearrangement of the alternate allele, a process referred to as allelic exclusion. This process ensures that most alpha beta T cells express a single TCR beta  chain and most B cells express single IgH and IgL chains. Assembly of TCR alpha  and TCR gamma  chain variable region genes exhibit allelic inclusion and alpha beta and gamma delta T cells can express two TCR alpha  or TCR gamma chains, respectively. However, it was not known whether assembly of TCR delta  variable regions genes is regulated in the context of allelic exclusion. To address this issue, we have analyzed TCR delta  rearrangements in a panel of mouse splenic gamma delta T cell hybridomas. We find that, similar to TCR alpha  and gamma  variable region genes, assembly of TCR delta  variable region genes exhibits properties of allelic inclusion. These findings are discussed in the context of gamma delta T cell development and regulation of rearrangement of TCR delta  genes.

Key words: T cellsgamma delta T cellsT cell receptor rearrangementallelic exclusionT cell receptor delta
    Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Lymphocyte antigen receptor variable region genes are assembled during development from component variable (V),1 diversity (D), and joining (J) gene segments in the case of the TCR beta  and delta  chain genes and the Ig heavy (H) chain gene or from V and J gene segments in the case of TCR alpha  and gamma  chain genes and Ig light (L) chain genes (1, 2). Productive rearrangement of TCR beta  or IgH chain variable region genes results in cessation of further V to DJ rearrangements on the alternate allele, a process referred to as allelic exclusion (2, 3). "Functional" rearrangement of IgL kappa  or lambda  L chain genes (i.e., rearrangements which generate an IgL chain that can pair with a pre-existing IgH chain) also lead to cessation of further IgL chain rearrangements resulting in both allelic and IgL chain isotype exclusion (4). In contrast, TCR alpha  and TCR gamma  chain variable region gene assembly does not exhibit properties of allelic exclusion (3, 5). Consequently alpha beta and gamma delta T cells can express two TCR alpha  or gamma  chains, respectively (6, 7).

Several models have been proposed to account for allelic exclusion. One model proposed that the probability of a productive rearrangement is low making it unlikely that an individual cell could have two productive rearrangements (8). However, it is now known that the probability of a productive rearrangement can be as high as 33% (9). Another model proposed that the probability of two complete V(D)J rearrangements in any one cell was low. However, a significant percentage of peripheral B and T cells have two IgH or TCR beta  V(D)J rearrangements, respectively, arguing against this model (3, 10). It has been proposed that IgH chain allelic exclusion occurs due to a toxic effect of expressing two IgH chains (11). However, the recent demonstration that B cell development proceeds normally in mice that express two IgH transgenes essentially rules out this model (12). An early model, based on analyses of rearrangement patterns in cell lines, proposed that allelic exclusion is regulated and that expression of a productively rearranged IgH or IgL chain prevents further rearrangements at the IgH and IgL chain loci, respectively (4, 13, 14). This regulated model was supported by studies demonstrating that expression of IgH or IgL transgenes resulted in a block in endogenous IgH or IgL chain gene rearrangement, respectively (15). Studies of TCR beta  transgenic mice have supported an analogous model by which the TCR beta  transgene feeds back to block endogenous TCR beta  rearrangements (19). In addition, it has recently been demonstrated that expression of IgH or TCR beta  chains as pre-B or pre-T cell receptors, respectively, is required for allelic exclusion (20).

T cells can be divided into two distinct lineages based on expression of either alpha beta or gamma delta TCRs. The genes that encode the TCR beta  and TCR gamma  chains lie in distinct loci, whereas the genes that encode the TCR delta  and TCR alpha  chains lie in a single locus (TCR alpha /delta locus; Fig. 1; references 24, 25). In the adult thymus TCR beta  rearrangements are initiated at the CD4-/CD8- (double negative, DN) stage of thymocyte development and are ordered with Dbeta to Jbeta rearrangement occurring on both alleles before Vbeta to DJbeta rearrangement (3, 26, 27). Once a productive V(D)Jbeta rearrangement is made and a TCR beta  chain expressed, cells proceed to the CD4+/CD8+ (double positive, DP) stage of development and further Vbeta to DJbeta rearrangements cease (3, 26, 27). As a result, many alpha beta T cells have DJbeta rearrangements on a single allele (28). Valpha to Jalpha rearrangements are initiated at the DP stage. However, unlike the TCR beta  locus, expression of a TCR alpha  chain does not result in cessation of Valpha to Jalpha rearrangements (3, 26, 27). This process continues on both alleles, and Valpha to Jalpha rearrangements can result in the deletion of previously assembled productive VJalpha rearrangements (29). It has been proposed that the downregulation of recombinase activating gene (RAG) gene expression may ultimately be responsible for termination of Valpha to Jalpha rearrangement (30).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic of the mouse TCR alpha /delta locus. Shown are the Valpha /Vdelta gene segments, the Ddelta and Jdelta gene segments, the TCR delta  enhancer (Edelta ), the TCR delta  constant region gene (Cdelta ), and the Vdelta 5 gene segment. This is followed by the Jalpha gene segments, the TCR alpha  constant region gene (Calpha ), and the TCR alpha  enhancer (Ealpha ). Also shown are probes 1 and 3 through 6 and the approximate position of the BglII (B2) sites. The schematic is not drawn to scale.

Several notable differences exist between the developmental regulation of assembly of alpha beta and gamma delta TCR variable region genes. Assembly of TCR gamma  and TCR delta  variable region genes occurs at the DN stage of thymocyte development (31). It is not known whether rearrangement of these genes is concurrent or sequential. In addition, assembly of TCR gamma  genes does not appear to exhibit allelic exclusion (7). Similar to the TCR beta  locus, assembly of TCR delta  variable region genes does not proceed to completion on all alleles. However, unlike the TCR beta  locus, TCR delta  variable region gene assembly does not appear to be ordered, since incomplete DDdelta , DJdelta and VDdelta rearrangements have been described (32, 33). It is unresolved whether productive TCR delta  rearrangements lead to termination of further TCR delta  rearrangements (allelic exclusion) or whether TCR delta  rearrangements are limited by factors independent of the formation of productive rearrangements. To address this issue, we have analyzed TCR delta  rearrangements in a panel of T cell hybridomas derived from splenic gamma delta T cells. We find the percentage of cells with two in-frame V(D)Jdelta rearrangements is similar to that predicted in the absence of allelic exclusion. These findings are discussed in the context of gamma delta T cell development.

    Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Isolation of gamma delta T Cells and Production of gamma delta T Cell Hybridomas.

Whole spleen cell suspensions from C57BL6 × CBA mice were incubated in DMEM-15 containing 40 U recombinant human IL-2/ml (PharMingen, San Diego, CA) on plates that had been coated with 10 µg/ml rat anti-hamster Ig (PharMingen) followed by 10 µg/ml of an anti-TCR delta  chain mAb (GL4; PharMingen). Cultures were maintained for 6 d and the resulting cells were >90% pure gamma delta T cells as determined by flow cytometry (data not shown). Hybridomas were produced by fusing these gamma delta T cells to the thymoma BW-1100.129.237 using a fusion protocol that has been described elsewhere (34, 35).

Flow Cytometry.

Single cell suspensions were prepared from thymus, spleen and lymph nodes as previously described (36). Hybridomas were stained with FITC-conjugated anti-TCR beta  chain (H57-597) and PE-conjugated anti-TCR delta  chain (GL3) monoclonal antibodies from PharMingen and were analyzed by a FACScan® (Becton Dickinson & Co., Sparks, MD).

Genomic DNA Analysis.

Genomic DNA was isolated and Southern blotting carried out as previously described using Zetaprobe membranes (Bio-Rad Laboratories, Hercules, CA) and probes generated by random hexamer priming (Boehringer Mannheim Corp., Indianapolis, IN) using alpha -[32P]dCTP (34, 35). Probe 1 is a 600-bp HindIII fragment (39). Probe 3 is a 550-bp Msp1 to Nde1 fragment and probe 4 a 1-kb Nde1-Xba1 fragment from pTAE-7 (40). Probe 5 is a 350-bp PCR product generated as described elsewhere (41). Probe 6 is a 1.5-kb EcoRI Cdelta cDNA fragment (42).

PCR and Sequence Analysis.

PCR reactions were carried out using 200 ng of genomic DNA isolated from hybridomas and 2.5 U AmpliTaq polymerase (Perkin-Elmer Corp., Norwalk, CT). PCR conditions were: 92°C for 1 min 30 s, 62°C for 2 min 30 s, 72°C for 1 min 30 s cycled 30 times. PCR products were subcloned into pT7blue (Novagen Inc., Madison, WI) before sequencing on a ABI Prism 377 DNA sequencer (Perkin-Elmer Corp.). The Vdelta nomenclature of Arden et al. (43) is used. The Vdelta and Jdelta primers used to PCR VDJdelta joins were as follows: Vdelta primers: ADV7S (Vdelta 7/Vdelta 6), TCACCCTGGACTGTTCATAT; ADV11S5, ATTTTACGACCACCATGAGG; ADV17S2 (Vdelta 9), ATGCTGATTCTAAGCCTGCT; DV2S8 (Vdelta 8), AGCAGGTGAGACAAAGTCC; DV4S8, ACGATAGAGTGCAACTACTCA; DV6S2 (Vdelta 3), ATGGGATGTGTGAGTGGAAT; V10S7 (Vdelta 7), TGAAGAGGCTGCTGTGCTC; DV101S1 (Vdelta 1), ATGCTTTGGAGATGTCCAGT; DV102S1(Vdelta 2), ATGGGGATGTTCCTTCAAGT; DV104S1(Vdelta 4), CAGGTGGCAGAATCAGCAA; DV105S1(Vdelta 5), ATGATTGTTGCCGCGACCC; Jdelta primers: Jdelta 1, AGAGTCCAAGAATCATCTACG; Jdelta 2, CTTCTGTGTACTACTTTTATTTTC.

Southern blotting of PCR products was carried out with internal oligos to Jdelta 1 (CGACAAACTCGTCTTTGG) or Jdelta 2 (CTCCTGGGACACCCGACAGA).

Theoretical Determination of In-Frame Rearrangement Percentages.

All mature gamma delta T cells must have at least one productive VDJdelta rearrangement. If the probability that a VDJdelta rearrangement will be in-frame equals P then the probability that a VDJdelta rearrangement will be out of frame will be (1 - P). If there is an equal chance of a rearrangement in each of the three reading frames then P = 1/3. In the absence of allelic exclusion and in cells with two VDJdelta rearrangements, the percentage of cells with two in-frame TCR delta  rearrangements will be equal to the probability that the cell will have two in-frame rearrangements divided by the probability that the cell will have at least one in-frame rearrangement.
<FR><NU>P<SUP>2</SUP></NU><DE>1−(1−P)<SUP>2</SUP></DE></FR>=<FR><NU><FENCE><FR><NU>1</NU><DE>3</DE></FR></FENCE><SUP>2</SUP></NU><DE>1−<FENCE>1−<FR><NU>1</NU><DE>3</DE></FR></FENCE><SUP>2</SUP></DE></FR>=<FR><NU><FR><NU>1</NU><DE>9</DE></FR></NU><DE>1−<FENCE><FR><NU>2</NU><DE>3</DE></FR></FENCE><SUP>2</SUP></DE></FR>=<FR><NU>1</NU><DE>5</DE></FR>

    Results
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Generation of gamma delta T Cell Hybridomas.

Splenic gamma delta T cell hybridomas were generated from C57BL6 × CBA F1 mice by stimulating unfractionated spleen cells with plate-bound anti-TCR delta  antibody (GL3) as described in Materials and Methods section. The resulting cell population was >90% pure gamma delta T cells as determined by flow cytometry (data not shown). These cells were fused to the BW-1100.129.237 (BW) thymoma which is incapable of producing TCR delta , beta , or alpha  chains (35). T cell hybridomas generated by fusion of a gamma delta T cell to BW were identified by flow cytometric analysis of cell surface TCR delta  expression (data not shown). Only those hybridomas that expressed TCR delta  were chosen for further analysis.

To ensure that both TCR delta  alleles were present in the resulting panel of gamma delta T cell hybridomas genomic DNA isolated from these hybridomas was assayed by Southern blot analyses using TCR delta  restriction fragment length polymorphisms that exist between C57BL6 and CBA mice (44). Genomic DNA isolated from gamma delta T cell hybridomas was digested with HindIII and subjected to Southern blot analysis using probe 6 which is directed against the TCR delta  constant region gene (Cdelta ; Figs. 1 and 2). Probe 6 hybridizing bands are not found in BW as Cdelta has been deleted on both alleles due to Valpha to Jalpha rearrangements (Fig. 2). Using probe 6, distinct size bands are generated by the C57BL6 and CBA TCR delta  alleles, and hybridomas that had lost either allele (for example F1D.11) were excluded from further analysis (Fig. 2).


View larger version (K):
[in this window]
[in a new window]
 
Fig. 2.   Analysis for the presence of the CBA and C57BL6 TCR delta  alleles. Genomic DNA from the hybridoma fusion partner BW 1100.129.237 (BW), CBA kidney (CBA), C57BL6 kidney (B6), or gamma delta T cell hybridomas (F1D) was digested with HindIII and subjected to Southern blot analysis using probe 6 (Fig. 1). The 2-kb marker is shown.

To determine whether the gamma delta T cell hybridomas chosen for analysis were clonal, genomic DNA was subjected to Southern blot analysis using probe 4 to detect rearrangements to Jdelta 1 (Fig. 3 a), probe 5 to detect rearrangements to Jdelta 2 (Fig. 3 b) or a probe that detects rearrangements to Jbeta 2 (data not shown). Hybridomas that were oligoclonal on the basis of having three or more TCR delta  or TCR beta  rearrangements were excluded from further analysis. The resulting 27 gamma delta T cell hybridomas that satisfied the above criteria were characterized further.


View larger version (93K):
[in this window]
[in a new window]
 


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 3.   Analysis of rearrangements to Jdelta 1 and Jdelta 2. Genomic DNA samples described in the legend to Fig. 1 were digested with either BglII (a) or HindIII (b) and subjected to Southern blot analysis using probes 1, 3, and 4 (a) or probe 5 (b). Shown are the 9-, 6- and 4-kb molecular mass markers.

TCR delta  Allele Configurations in gamma delta T Cell Hybridomas.

To determine the extent of TCR delta  rearrangement in the panel of gamma delta T cell hybridomas, hybridoma genomic DNA was digested with BglII and subjected to Southern blot analysis using probe 4 (Figs. 1 and 3 a, data not shown). None of the hybridomas exhibited germline size bands, demonstrating that most TCR delta  alleles are rearranged in splenic gamma delta T cells (Fig. 3 a, data not shown). In addition, most hybridomas gave two bands with probe 4, showing that most TCR delta  rearrangements in splenic gamma delta T cells use the Jdelta 1 gene segment. F1D.58 exhibited single nongermline bands with probes 4 and 5, demonstrating that it had undergone rearrangements to Jdelta 1 and Jdelta 2 (Fig. 3 b). All other hybridomas exhibited germline bands from the C57BL6 and CBA TCR delta  alleles using probe 5, showing that there is minimal rearrangement to the Jdelta 2 gene segment in splenic gamma delta T cell hybridomas analyzed here (Fig. 3 b, data not shown).

To assay for incomplete TCR delta  rearrangements, BglII-digested hybridoma genomic DNA was probed with probes 1 and 3 (Figs. 1 and 3 a, data not shown). Probe 1 hybridizing bands of similar size to probe 4 hybridizing bands would be generated by alleles that have undergone Ddelta 1 to Ddelta 2 or Ddelta 1 to Jdelta 1 rearrangements. Hybridomas F1D.19, 45, 51, 55, 71, and 72 all exhibit a 4.5-kb BglII band with probes 1 and 4 (Fig. 3 a, Table 1, data not shown), whereas hybridoma F1D.58 yields a 5.5-kb BglII band with probes 1 and 4 (Fig. 3 a and Table 1). To determine which hybridomas had undergone a Ddelta 1 to Ddelta 2 rearrangement, BglII-digested DNA was assayed with a probe (probe 3) to the region between Ddelta 1 and Ddelta 2 which will be deleted upon Ddelta 1 to Ddelta 2 rearrangement (Fig. 1). F1D.58 has a 5.5-kb BglII band that hybridizes to probe 3, demonstrating that one of the alleles in this hybridoma has undergone a Ddelta 1 to Ddelta 2 rearrangement (Fig. 3 a, Table 1). The hybridomas that yielded a 4.5-kb BglII band with probes 1 and 4 do not have probe 3 hybridizing bands, demonstrating that they have undergone Ddelta 1 to Jdelta 1 rearrangements (Fig. 3 a).

                              
View this table:
[in this window]
[in a new window]
 

Table 1
gamma delta T Cell Hybridomas with One Complete VDJdelta Rearrangement

The DV105S1 (Vdelta 5) gene segment rearranges by inversion and, therefore, a nongermline probe 1 hybridizing band should be generated by the reciprocal product of a DV105S1 to Ddelta 1 rearrangement. Furthermore, this band would likely be of a different size than the probe 4 hybridizing band generated by the same rearrangement. Hybridomas F1D.17, 23, 32, and 61 all have 9-kb BglII probe 1 hybridizing bands (Fig. 3 a, data not shown). None of these hybridomas has a 9-kb probe 4 hybridizing BglII band, and each was found to have a DV105S1 to Jdelta 1 rearrangement by PCR analysis (Table 2). Finally, Vdelta to Ddelta rearrangements by Vdelta gene segments other than DV105S1 will result in loss of probe 1 hybridizing bands and generation of a non-germline probe 3 hybridizing band that should be similar in size to the band generated by probe 4 when probing BglII-digested DNA. In this regard F1D.68 has a 3.5-kb BglII band that hybridizes to probes 3 and 4 and was found to have a Vdelta to Ddelta 2 rearrangement by PCR analysis (Fig. 3 a, Table 1).

                              
View this table:
[in this window]
[in a new window]
 

Table 2
gamma delta T Cell Hybridomas with Two Complete VDJdelta Rearrangements

These Southern blot analyses revealed that, of the 27 gamma delta T cell hybridomas analyzed, all had complete V(D)J delta  rearrangements on one allele (Fig. 3, a and b, Tables 1 and 2. On the other allele, 19 hybridomas also had complete V(D)J delta  rearrangements, one had a Ddelta 1Ddelta 2 rearrangement, one had a VDdelta 2 rearrangement and 6 had Ddelta 1Jdelta 1 rearrangements (Fig. 3 a, Table 1). In addition, the Jdelta 2 gene segment was used in only one rearrangement (Fig. 3 b, Table 1).

Analysis of V(D)Jdelta Rearrangements in gamma delta T Cell Hybridomas.

Using primers that should recognize the members of the 11 known mouse Vdelta gene families in conjunction with primers that were just downstream of Jdelta 1 or Jdelta 2, PCR analysis was carried out on all hybridomas to determine Vdelta gene segment usage (Tables 1 and ;reference2. By this analysis none of the hybridomas analyzed gave more than two distinct PCR products (data not shown). PCR products from the 19 hybridomas that had two complete V(D)Jdelta rearrangements were cloned and sequenced. None of the V(D)Jdelta rearrangements isolated used known Vdelta pseudogenes (43). Two distinct rearrangements were isolated from 16 of the 19 hybridomas determined to have two V(D)Jdelta rearrangements. All hybridomas had at least one in-frame V(D)Jdelta rearrangement except for F1D.64 in which only a single out of frame V(D)Jdelta rearrangement was isolated (Table 2). The other allele of this hybridoma must have an in-frame V(D)Jdelta rearrangement, that was undetected by this analysis, as it expresses a TCR delta chain (data not shown). Only a single in-frame rearrangement was isolated from F1D.36 and F1D.91. The inability to detect more than a single rearrangement in these hybridomas could be due to the use of novel Vdelta gene segments unable to be detected by the primer set used in this analysis. Alternatively, these hybridomas may have two rearrangements involving members of the same Vdelta gene family that were not both detected upon nucleotide sequence analysis. Significantly, analyses of the 17 hybridomas with two defined V(D)Jdelta joins revealed that 6 had two in-frame rearrangements, demonstrating that assembly of TCR delta  variable region genes does not exhibit allelic exclusion (Table 2).

    Discussion
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

To determine if assembly of TCR delta  variable region genes is regulated in the context of allelic exclusion, we have analyzed a panel of 27 clonal hybridomas derived from mouse splenic gamma delta T cells. Of the 17 hybridomas with defined V(D)Jdelta rearrangements on both alleles, 6 (35%) have two in-frame rearrangements. This demonstrates that TCR delta  variable region gene assembly does not exhibit allelic exclusion. Although this percentage is higher than the 20% (see Materials and Methods for calculations), which would be expected in the absence of allelic exclusion, this difference is not statistically significant (P > 0.10). Two human gamma delta T cell clones with in-frame TCR delta  rearrangements on both alleles have been described previously (33, 45). However, given the number of cells analyzed in these studies, it was not possible to determine whether these clones represented rare events or a general lack of TCR delta  allelic exclusion. As TCR gamma  rearrangements do not exhibit allelic exclusion, failure of TCR delta  allelic exclusion further increases the possibility that a single gamma delta T cell will express two or more distinct gamma delta TCRs (7).

It is possible that one of the TCR delta  rearrangements in each of the six cells with two in-frame rearrangements encodes for a TCR delta  chain that cannot be expressed on the surface of the cell and therefore would not signal a block of further TCR delta  rearrangements. This may occur, for example, if the TCR delta  chain were not able to pair with a TCR gamma  chain or a component of a gamma delta pre-TCR, if such a receptor exists. In this regard, it has recently been shown that 2-4% of peripheral B cells have two in-frame IgH rearrangements but that only one encodes for an IgH chain that is capable of forming a pre-B cell receptor (22). Our data is more consistent with the notion that assembly of TCR delta  variable region genes exhibits properties of allelic inclusion as the percentage of gamma delta T cell hybridomas with two in-frame TCR delta  rearrangements is in agreement with the percentage expected in the absence of allelic exclusion. Furthermore, this percentage is similar to that of alpha beta T cells with two in-frame rearrangements at the TCR alpha  locus, which also exhibits allelic inclusion (3).

It has been proposed for the IgH locus (and by analogy for the TCR beta  locus) that the precise ordering of variable gene segment rearrangement during lymphocyte development may be important for effecting allelic exclusion (14). In both of these loci, D to J rearrangement occurs on both alleles before V to DJ rearrangement. Presumably V to DJ rearrangement proceeds initially on one allele, at which point the rearrangement is "tested." If it encodes a protein that can be expressed, signals are generated that prevent further V to DJ rearrangements on the other allele. In accordance with this model, the expected number of B and T cells have V(D)J/DJ configured rearrangements of their IgH and TCR beta  alleles, respectively (3, 10).

Unlike the IgH and TCR beta  loci, assembly of TCR delta  variable gene segments is not ordered during development, and we now show that the TCR delta  locus is not regulated in the context of allelic exclusion. However, the finding that many gamma delta T cells have incomplete TCR delta  rearrangements demonstrates that rearrangement is frequently terminated before completion. The events that lead to termination of TCR delta  rearrangement are not known. Thymic gamma delta T cells do not express RAG-1 or RAG-2, and it is possible, as proposed for TCR alpha  rearrangement, that down regulation of RAG expression leads to termination of TCR delta  rearrangement (30, 46). Termination of TCR delta  rearrangement, by whatever mechanism, may be part of a developmental program that is independent of TCR delta  expression. Alternatively, rearrangement may cease upon TCR delta  expression, and failure of allelic exclusion may be due to the unordered simultaneous rearrangement of TCR delta  alleles.

    Footnotes

Address correspondence to Frederick W. Alt, Howard Hughes Medical Institute, Children's Hospital, Longwood Ave., Boston, MA 02115. Phone: 617-355-7290; Fax: 617-730-0432; E-mail: alt{at}rascal.med.harvard.edu

Received for publication 28 July 1998.

   B.P. Sleckman's present address is Department of Pathology, Washington University School of Medicine, 660 S. Euclid Ave., St. Louis, MO 63110.
   The first two authors contributed equally to this study.

We thank F. Livak and D. Schatz for providing us with probes and C.H. Bassing for critical review of the manuscript.

This work is supported by the Howard Hughes Medical Institute and by National Institutes of Health grants AI20047 (F.W. Alt) and AI01297-01 (B.P. Sleckman). B.P. Sleckman is a recipient of a Career Development Award in the Biomedical Sciences from the Burroughs Wellcome Fund.

Abbreviations used in this paper BW, BW-1100.129.237; D, diversity; DN, double negative; DP, double positive; H, heavy; J, joining; L, light; RAG, recombinase activating gene; V, variable.

    References
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Sleckman, B.P., J.R. Gorman, and F.W. Alt. 1996. Accessibility control of antigen-receptor variable-region gene assembly: role of cis-acting elements. Annu. Rev. Immunol. 14: 459-481 [Medline].
2. Okada, A., and F.W. Alt. 1994. Mechanisms that control antigen receptor variable region gene assembly. Sem. Immunol. 6: 185-196 [Medline].
3. Malissen, M., J. Trucy, E. Jouvin-Marche, P.-A. Cazenave, R. Scollay, and B. Malissen. 1992. Regulation of TCR alpha  and beta  gene allelic exclusion during T cell development. Immunol. Today. 13: 315-322 [Medline].
4. Alt, F.W., V. Enea, A.L. Bothwell, and D. Baltimore. 1980. Activity of multiple light chain genes in murine multiple myeloma cells producing a single, functional light chain. Cell. 21: 1-12 [Medline].
5. Casanova, J.-L., P. Romero, C. Widmann, P. Kourilsky, and J.L. Maryanski. 1991. T cell receptor genes in a series of class I major histocompatibility complex-restricted cytotoxic T lymphocyte clones specific for Plasmodium berghei nonapeptide: Implications for T cell allelic exclusion and antigen-specific repertoire. J. Exp. Med. 174: 1371-1383 [Abstract/Free Full Text].
6. Padovan, E., G. Casorati, P. Dellabona, S. Meyer, M. Brockhaus, and A. Lanzavecchia. 1993. Expression of two T cell receptor alpha  chains: dual receptor T cells. Science. 262: 422-424 [Abstract/Free Full Text].
7. Davodeau, F., M.-A. Peyrat, I. Houde, M.-M. Hallet, G. De Libero, H. Vie, and M. Bonneville. 1993. Surface expression of two distinct functional antigen receptors on human gamma delta T cells. Science. 260: 1800-1802 [Abstract/Free Full Text].
8. Coleclough, C., R.P. Perry, K. Karjalainen, and M. Weigert. 1981. Aberrant rearrangements contribute significantly to allelic exclusion of immunoglobulin gene expression. Nature. 290: 372-378 [Medline].
9. Lansford, R., A. Okada, J. Chen, E.M. Oltz, T.K. Blackwell, F.W. Alt, and G. Rathbun. Mechanism and control of immunoglobulin gene rearrangement. In Molecular Immunology-Frontiers in Molecular Biology. 2nd edition. D.B. Hames, and D.M. Glover, editors. IRL Press, New York. 1-100.
10. ten Boekel, E., F. Melchers, and A. Rolink. 1995. The status of Ig rearrangements in single cells from different stages of B cell development. Int. Immunol. 7: 1013-1019 [Abstract/Free Full Text].
11. Wabl, M., and C. Steinberg. 1982. A theory of allelic exclusion for the immunoglobulin genes. Proc. Natl. Acad. Sci. USA. 79: 6976-6978 [Abstract/Free Full Text].
12. Sonoda, E., Y. Pewzner-Jung, S. Schwers, S. Taki, S. Jung, D. Eilat, and K. Rajewsky. 1997. B cell development under the condition of allelic inclusion. Immunity. 6: 225-234 [Medline].
13. Alt, F.A., N. Rosenberg, S. Lewis, E. Thomas, and D. Baltimore. 1981. Organization and reorganization of immunoglobulin genes in A-MuLV-transformed cells: Rearrangement of heavy but not light chain genes. Cell. 27: 381-390 [Medline].
14. Alt, F.W., G.D. Yancopoulos, T.K. Blackwell, C. Wood, E. Thomas, M. Boss, R. Coffman, N. Rosenberg, S. Tonegawa, and D. Baltimore. 1984. Ordered rearrangement of immunoglobulin heavy chain variable region genes. EMBO (Eur. Mol. Biol. Organ.) 3: 1209-1219 [Medline].
15. Rusconi, S., and G. Kohler. 1985. Transmission and expression of a specific pair of rearranged immunoglobulin µ and kappa  genes in a transgenic mouse line. Nature. 314: 330-334 [Medline].
16. Weaver, D., F. Costantini, T. Imanishi-Kari, and D. Baltimore. 1985. A transgenic immunoglobulin mu gene prevents rearrangement of endogenous genes. Cell. 42: 117-127 [Medline].
17. Nussenzweig, M.C., A.C. Shaw, E. Sinn, D.B. Danner, K.L. Holmes, H.C. Morse III, and P. Leder. 1987. Allelic exclusion in mice that express the membrane form of immunoglobulin µ. Science. 236: 816-819 [Abstract/Free Full Text].
18. Storb, U., C. Pinkert, B. Arp, P. Engler, K. Gollahon, J. Manz, W. Brady, and R. Brinster. 1986. Transgenic mice with µ and kappa  encoding anti-phosphorylcholine antibodies. J. Exp. Med. 164: 627-638 [Abstract/Free Full Text].
19. Uematsu, Y., S. Ryser, Z. Dembic, P. Borgulya, P. Krimpenfort, A. Berns, H. von Boehmer, and M. Steinmetz. 1988. In transgenic mice the introduced functional T cell receptor beta  gene prevents expression of endogenous beta  genes. Cell. 52: 831-841 [Medline].
20. Loffert, D., A. Ehlich, W. Muller, and K. Rajewsky. 1996. Surrogate light chain expression is required to establish heavy chain allelic exclusion during B cell development. Immunity. 4: 133-144 [Medline].
21. Kitamura, D., and K. Rajewsky. 1992. Targeted disruption of µ chain membrane exon causes loss of heavy-chain allelic exclusion. Nature. 356: 154-156 [Medline].
22. ten Boekel, E., F. Melchers, and A.G. Rolink. 1998. Precursor B cells showing H chain allelic inclusion display allelic exclusion at the level of pre-B cell receptor surface expression. Immunity. 8: 199-208 [Medline].
23. Aifantis, I., J. Buer, H. von Boehmer, and O. Azogui. 1997. Essential role of the pre-T cell receptor in allelic exclusion. Immunity. 7: 601-608 [Medline].
24. Chien, Y.-H., M. Iwashima, K.B. Kaplan, J.F. Elliot, and M.M. Davis. 1987. A new T-cell receptor gene located within the alpha  locus and expressed early in T cell differentiation. Nature. 327: 677-682 [Medline].
25. Satyanarayana, K., S. Hata, P. Devlin, M.C. Roncarolo, J.E. De Vries, H. Spits, J.L. Strominger, and M.S. Krangel. 1988. Genomic organization of the human T-cell antigen-receptor alpha /delta locus. Proc. Natl. Acad. Sci. USA. 85: 8166-8170 [Abstract/Free Full Text].
26. Fehling, H.J., and H. von Boehmer. 1997. Early alpha beta T cell development in the thymus of normal and genetically altered mice. Curr. Opin. Immunol. 9: 263-275 [Medline].
27. Willerford, D.M., W. Swat, and F.W. Alt. 1996. Developmental regulation of V(D)J recombination and lymphocyte differentiation. Curr. Opin. Gen. Dev. 6: 603-609 [Medline].
28. Seboun, E., N. Joshi, and S. Hauser. 1992. Haplotypic origin of beta-chain genes expressed by human T-cell clones. Immunogenetics. 36: 363-368 [Medline].
29. Marolleau, J.-P., J.D. Fondell, M. Malissen, J. Trucy, E. Barbier, K.B. Marcu, P.-A. Cazenave, and D. Primi. 1988. The joining of germ-line Valpha to Jalpha genes replaces the preexisting Valpha -Jalpha complexes in a T cell receptor alpha ,beta positive T cell line. Cell. 55: 291-300 [Medline].
30. Borgulya, P., H. Kishi, Y. Uematsu, and H. von Boehmer. 1992. Exclusion and inclusion of alpha  and beta  T cell receptor alleles. Cell. 69: 529-537 [Medline].
31. Kang, J., and D.H. Raulet. 1997. Events that regulate differentiation of alpha beta TCR+ and gamma delta TCR+ T cells from a common precursor. Semin. Immunol. 9: 171-179 [Medline].
32. Chien, Y.-H., M. Iwashima, D.A. Wettstein, K.B. Kaplan, J.F. Elliot, W. Born, and M.M. Davis. 1987. T-cell receptor delta  gene rearrangements in early thymocytes. Nature. 330: 722-727 [Medline].
33. Migone, N., S. Padovan, C. Zappador, C. Glachino, M. Bottaro, G. Matullo, C. Carbonara, G. De Libero, and G. Casorati. 1995. Restriction of the T-cell receptor V delta gene repertoire is due to preferential rearrangement and is independent of antigen selection. Immunogenetics. 42: 323 [Medline].
34. Sleckman, B.P., C.G. Bardon, R. Ferrini, L. Davidson, and F.W. Alt. 1997. Function of the TCRalpha enhancer in alpha beta and gamma delta T cells. Immunity. 7: 505-515 [Medline].
35. White, J., M. Blackman, J. Bill, J. Kappler, P. Marrack, D. Gold, and W. Born. 1989. Two better cell lines for making hybridomas expressing specific T cell receptors. J. Immunol. 143: 1822-1825 [Abstract].
36. Chen, J., R. Lansford, V. Stewart, F. Young, and F.W. Alt. 1993. RAG-2-deficient blastocyst complementation: an assay of gene function in lymphocyte development. Proc. Natl. Acad. Sci. USA. 90: 4528-4532 [Abstract/Free Full Text].
37. Laird, P.W., A. Zijderveld, K. Linders, M.A. Rudnicki, R. Jaenisch, and A. Berns. 1991. Simplified mammalian DNA isolation procedure. Nucleic Acids Res. 19: 4293 [Free Full Text].
38. Yancopoulos, G.D., T.K. Blackwell, H. Suh, L. Hood, and F.W. Alt. 1986. Introduced T cell receptor variable region gene segments recombine in pre-B cells: evidence that B and T cells use a common recombinase. Cell. 44: 251-259 [Medline].
39. Korman, A.J., J. Maruyama, and D. Raulet. 1989. Rearrangement by inversion of a T-cell receptor delta  variable region gene located 3' of the delta  constant region gene. Proc. Natl. Acad. Sci. USA. 86: 267-271 [Abstract/Free Full Text].
40. Winoto, A., and D. Baltimore. 1989. Separate lineages of T cells expressing the alpha beta and gamma delta receptors. Nature. 338: 430-432 [Medline].
41. Livak, F., H.T. Petrie, I.N. Crispe, and D.G. Schatz. 1995. In-frame TCR delta  gene rearrangements play a critical role in the alpha beta /gamma delta T cell lineage decision. Immunity. 2: 617-627 [Medline].
42. Elliott, J.F., E.P. Rock, P.A. Patten, M.M. Davis, and Y.-H. Chen. 1988. The adult T-cell receptor delta -chain is diverse and distinct from that of fetal thymocytes. Nature. 331: 627-631 [Medline].
43. Arden, B., S.P. Clark, D. Kabelitz, and T.W. Mak. 1995. Mouse T-cell receptor variable gene segment families. Immunogenetics. 42: 501-530 [Medline].
44. Sleckman, B.P., C.H. Bassing, C.G. Bardon, A. Okada, B. Khor, J.-C. Bories, R. Monroe, and F.W. Alt. 1998. Accessibility control of variable region gene assembly during T cell development. Immunol. Rev. In press.
45. Krangel, M.S., H. Yssel, C. Brocklehurst, and H. Spits. 1990. A distinct wave of human T cell receptor gamma /delta lymphocytes in the early fetal thymus: evidence for controlled gene rearrangement and cytokine production. J. Exp. Med. 172: 847-859 [Abstract/Free Full Text].
46. Livak, F., A. Wilson, H.R. MacDonald, and D. Schatz. 1997. alpha beta lineage-committed thymocytes can be rescued by the gamma delta T cell receptor (TCR) in the absence of TCR beta  chain. Eur. J. Immunol. 27: 2948-2958 [Medline].

Copyright © 1998 by The Rockefeller University Press.
0022-1007/98/10/1465/07 $2.00

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 159K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow