|
||
Variable Region
Genes Exhibits Allelic Inclusion
By
From the Howard Hughes Medical Institute, Children's Hospital and Department of Genetics, Harvard Medical School and The Center for Blood Research, Boston, Massachusetts 02115
| |
Abstract |
|---|
|
|
|---|
The generation of a productive "in-frame" T cell receptor
(TCR
), immunoglobulin (Ig)
heavy (H) or Ig light (L) chain variable region gene can result in the cessation of rearrangement
of the alternate allele, a process referred to as allelic exclusion. This process ensures that most

T cells express a single TCR
chain and most B cells express single IgH and IgL chains.
Assembly of TCR
and TCR
chain variable region genes exhibit allelic inclusion and 
and 
T cells can express two TCR
or TCR
chains, respectively. However, it was not
known whether assembly of TCR
variable regions genes is regulated in the context of allelic
exclusion. To address this issue, we have analyzed TCR
rearrangements in a panel of mouse
splenic 
T cell hybridomas. We find that, similar to TCR
and
variable region genes, assembly of TCR
variable region genes exhibits properties of allelic inclusion. These findings
are discussed in the context of 
T cell development and regulation of rearrangement of TCR
genes.

T cells;
T cell receptor rearrangement;
allelic exclusion;
T cell
receptor
| |
Introduction |
|---|
|
|
|---|
Lymphocyte antigen receptor variable region genes are
assembled during development from component variable (V),1 diversity (D), and joining (J) gene segments in
the case of the TCR
and
chain genes and the Ig heavy
(H) chain gene or from V and J gene segments in the case
of TCR
and
chain genes and Ig light (L) chain genes
(1, 2). Productive rearrangement of TCR
or IgH chain
variable region genes results in cessation of further V to DJ
rearrangements on the alternate allele, a process referred to
as allelic exclusion (2, 3). "Functional" rearrangement of
IgL
or
L chain genes (i.e., rearrangements which generate an IgL chain that can pair with a pre-existing IgH
chain) also lead to cessation of further IgL chain rearrangements resulting in both allelic and IgL chain isotype exclusion (4). In contrast, TCR
and TCR
chain variable region gene assembly does not exhibit properties of allelic
exclusion (3, 5). Consequently 
and 
T cells can
express two TCR
or
chains, respectively (6, 7).
Several models have been proposed to account for allelic
exclusion. One model proposed that the probability of a
productive rearrangement is low making it unlikely that an
individual cell could have two productive rearrangements
(8). However, it is now known that the probability of a
productive rearrangement can be as high as 33% (9). Another model proposed that the probability of two complete
V(D)J rearrangements in any one cell was low. However, a
significant percentage of peripheral B and T cells have two
IgH or TCR
V(D)J rearrangements, respectively, arguing against this model (3, 10). It has been proposed that
IgH chain allelic exclusion occurs due to a toxic effect of expressing two IgH chains (11). However, the recent demonstration that B cell development proceeds normally in mice
that express two IgH transgenes essentially rules out this
model (12). An early model, based on analyses of rearrangement patterns in cell lines, proposed that allelic exclusion is
regulated and that expression of a productively rearranged
IgH or IgL chain prevents further rearrangements at the IgH
and IgL chain loci, respectively (4, 13, 14). This regulated
model was supported by studies demonstrating that expression of IgH or IgL transgenes resulted in a block in endogenous IgH or IgL chain gene rearrangement, respectively
(15). Studies of TCR
transgenic mice have supported
an analogous model by which the TCR
transgene feeds
back to block endogenous TCR
rearrangements (19). In
addition, it has recently been demonstrated that expression of
IgH or TCR
chains as pre-B or pre-T cell receptors,
respectively, is required for allelic exclusion (20).
T cells can be divided into two distinct lineages based on
expression of either 
or 
TCRs. The genes that encode the TCR
and TCR
chains lie in distinct loci,
whereas the genes that encode the TCR
and TCR
chains lie in a single locus (TCR
/
locus; Fig. 1; references 24, 25). In the adult thymus TCR
rearrangements
are initiated at the CD4
/CD8
(double negative, DN)
stage of thymocyte development and are ordered with D
to J
rearrangement occurring on both alleles before V
to
DJ
rearrangement (3, 26, 27). Once a productive V(D)J
rearrangement is made and a TCR
chain expressed, cells proceed to the CD4+/CD8+ (double positive, DP) stage of
development and further V
to DJ
rearrangements cease
(3, 26, 27). As a result, many 
T cells have DJ
rearrangements on a single allele (28). V
to J
rearrangements
are initiated at the DP stage. However, unlike the TCR
locus, expression of a TCR
chain does not result in cessation of V
to J
rearrangements (3, 26, 27). This process
continues on both alleles, and V
to J
rearrangements can
result in the deletion of previously assembled productive VJ
rearrangements (29). It has been proposed that the
downregulation of recombinase activating gene (RAG)
gene expression may ultimately be responsible for termination of V
to J
rearrangement (30).
|
Several notable differences exist between the developmental regulation of assembly of 
and 
TCR variable
region genes. Assembly of TCR
and TCR
variable region genes occurs at the DN stage of thymocyte development (31). It is not known whether rearrangement of these
genes is concurrent or sequential. In addition, assembly of
TCR
genes does not appear to exhibit allelic exclusion (7). Similar to the TCR
locus, assembly of TCR
variable region genes does not proceed to completion on all alleles.
However, unlike the TCR
locus, TCR
variable region
gene assembly does not appear to be ordered, since incomplete DD
, DJ
and VD
rearrangements have been described (32, 33). It is unresolved whether productive TCR
rearrangements lead to termination of further TCR
rearrangements (allelic exclusion) or whether TCR
rearrangements are limited by factors independent of the formation of
productive rearrangements. To address this issue, we have
analyzed TCR
rearrangements in a panel of T cell hybridomas derived from splenic 
T cells. We find the percentage of cells with two in-frame V(D)J
rearrangements is similar to that predicted in the absence of allelic exclusion. These findings are discussed in the context of 
T
cell development.
| |
Materials and Methods |
|---|
|
|
|---|
Isolation of 
T Cells and Production of 
T Cell Hybridomas.
chain mAb (GL4; PharMingen).
Cultures were maintained for 6 d and the resulting cells were
>90% pure 
T cells as determined by flow cytometry (data not
shown). Hybridomas were produced by fusing these 
T cells to
the thymoma BW-1100.129.237 using a fusion protocol that has
been described elsewhere (34, 35).
Flow Cytometry.
Single cell suspensions were prepared from thymus, spleen and lymph nodes as previously described (36). Hybridomas were stained with FITC-conjugated anti-TCR
chain (H57-597) and PE-conjugated anti-TCR
chain (GL3)
monoclonal antibodies from PharMingen and were analyzed by a
FACScan® (Becton Dickinson & Co., Sparks, MD).
Genomic DNA Analysis.
Genomic DNA was isolated and Southern blotting carried out as previously described using Zetaprobe membranes (Bio-Rad Laboratories, Hercules, CA) and probes generated by random hexamer priming (Boehringer Mannheim Corp., Indianapolis, IN) using
-[32P]dCTP (34, 35). Probe
1 is a 600-bp HindIII fragment (39). Probe 3 is a 550-bp Msp1 to
Nde1 fragment and probe 4 a 1-kb Nde1-Xba1 fragment from
pTAE-7 (40). Probe 5 is a 350-bp PCR product generated as described elsewhere (41). Probe 6 is a 1.5-kb EcoRI C
cDNA fragment (42).
PCR and Sequence Analysis.
PCR reactions were carried out using 200 ng of genomic DNA isolated from hybridomas and 2.5 U AmpliTaq polymerase (Perkin-Elmer Corp., Norwalk, CT). PCR conditions were: 92°C for 1 min 30 s, 62°C for 2 min 30 s, 72°C for 1 min 30 s cycled 30 times. PCR products were subcloned into pT7blue (Novagen Inc., Madison, WI) before sequencing on a ABI Prism 377 DNA sequencer (Perkin-Elmer Corp.). The V
nomenclature of Arden et al. (43) is used. The V
and J
primers used to PCR VDJ
joins were as follows: V
primers: ADV7S (V
7/V
6), TCACCCTGGACTGTTCATAT;
ADV11S5, ATTTTACGACCACCATGAGG; ADV17S2 (V
9),
ATGCTGATTCTAAGCCTGCT; DV2S8 (V
8), AGCAGGTGAGACAAAGTCC; DV4S8, ACGATAGAGTGCAACTACTCA; DV6S2 (V
3), ATGGGATGTGTGAGTGGAAT; V10S7
(V
7), TGAAGAGGCTGCTGTGCTC; DV101S1 (V
1), ATGCTTTGGAGATGTCCAGT; DV102S1(V
2), ATGGGGATGTTCCTTCAAGT; DV104S1(V
4), CAGGTGGCAGAATCAGCAA; DV105S1(V
5), ATGATTGTTGCCGCGACCC; J
primers: J
1, AGAGTCCAAGAATCATCTACG; J
2, CTTCTGTGTACTACTTTTATTTTC.
Southern blotting of PCR products was carried out with internal oligos to J
1 (CGACAAACTCGTCTTTGG) or J
2 (CTCCTGGGACACCCGACAGA).
Theoretical Determination of In-Frame Rearrangement Percentages.
All mature
T cells must have at least one productive VDJ
rearrangement. If the probability that a VDJ
rearrangement will be
in-frame equals P then the probability that a VDJ
rearrangement will be out of frame will be (1
P). If there is an equal chance of a rearrangement in each of the three reading frames then P = 1/3. In the absence of allelic exclusion and in cells with two VDJ
rearrangements, the percentage of cells with two in-frame TCR
rearrangements will be equal to the probability that
the cell will have two in-frame rearrangements divided by the
probability that the cell will have at least one in-frame rearrangement.
|
| |
Results |
|---|
|
|
|---|

T Cell Hybridomas.
Splenic 
T cell
hybridomas were generated from C57BL6 × CBA F1
mice by stimulating unfractionated spleen cells with plate-bound anti-TCR
antibody (GL3) as described in Materials and Methods section. The resulting cell population was
>90% pure 
T cells as determined by flow cytometry
(data not shown). These cells were fused to the BW-1100.129.237 (BW) thymoma which is incapable of producing TCR
,
, or
chains (35). T cell hybridomas
generated by fusion of a 
T cell to BW were identified
by flow cytometric analysis of cell surface TCR
expression (data not shown). Only those hybridomas that expressed TCR
were chosen for further analysis.
To ensure that both TCR
alleles were present in the
resulting panel of 
T cell hybridomas genomic DNA isolated from these hybridomas was assayed by Southern blot
analyses using TCR
restriction fragment length polymorphisms that exist between C57BL6 and CBA mice (44).
Genomic DNA isolated from 
T cell hybridomas was digested with HindIII and subjected to Southern blot analysis using probe 6 which is directed against the TCR
constant
region gene (C
; Figs. 1 and 2). Probe 6 hybridizing bands
are not found in BW as C
has been deleted on both alleles
due to V
to J
rearrangements (Fig. 2). Using probe 6, distinct size bands are generated by the C57BL6 and CBA
TCR
alleles, and hybridomas that had lost either allele
(for example F1D.11) were excluded from further analysis
(Fig. 2).
|
To determine whether the 
T cell hybridomas chosen
for analysis were clonal, genomic DNA was subjected to
Southern blot analysis using probe 4 to detect rearrangements to J
1 (Fig. 3 a), probe 5 to detect rearrangements to
J
2 (Fig. 3 b) or a probe that detects rearrangements to J
2
(data not shown). Hybridomas that were oligoclonal on the
basis of having three or more TCR
or TCR
rearrangements were excluded from further analysis. The resulting
27 
T cell hybridomas that satisfied the above criteria
were characterized further.
|
Allele Configurations in 
T Cell Hybridomas.
To determine the extent of TCR
rearrangement in the
panel of 
T cell hybridomas, hybridoma genomic DNA
was digested with BglII and subjected to Southern blot
analysis using probe 4 (Figs. 1 and 3 a, data not shown).
None of the hybridomas exhibited germline size bands,
demonstrating that most TCR
alleles are rearranged in
splenic 
T cells (Fig. 3 a, data not shown). In addition, most hybridomas gave two bands with probe 4, showing
that most TCR
rearrangements in splenic 
T cells use
the J
1 gene segment. F1D.58 exhibited single nongermline bands with probes 4 and 5, demonstrating that it had
undergone rearrangements to J
1 and J
2 (Fig. 3 b). All
other hybridomas exhibited germline bands from the C57BL6
and CBA TCR
alleles using probe 5, showing that there
is minimal rearrangement to the J
2 gene segment in
splenic 
T cell hybridomas analyzed here (Fig. 3 b, data
not shown).
To assay for incomplete TCR
rearrangements, BglII-digested hybridoma genomic DNA was probed with probes
1 and 3 (Figs. 1 and 3 a, data not shown). Probe 1 hybridizing bands of similar size to probe 4 hybridizing bands
would be generated by alleles that have undergone D
1 to
D
2 or D
1 to J
1 rearrangements. Hybridomas F1D.19,
45, 51, 55, 71, and 72 all exhibit a 4.5-kb BglII band with
probes 1 and 4 (Fig. 3 a, Table 1, data not shown), whereas hybridoma F1D.58 yields a 5.5-kb BglII band with probes
1 and 4 (Fig. 3 a and Table 1). To determine which hybridomas had undergone a D
1 to D
2 rearrangement, BglII-digested DNA was assayed with a probe (probe 3) to the
region between D
1 and D
2 which will be deleted upon
D
1 to D
2 rearrangement (Fig. 1). F1D.58 has a 5.5-kb
BglII band that hybridizes to probe 3, demonstrating that
one of the alleles in this hybridoma has undergone a D
1 to D
2 rearrangement (Fig. 3 a, Table 1). The hybridomas
that yielded a 4.5-kb BglII band with probes 1 and 4 do
not have probe 3 hybridizing bands, demonstrating that
they have undergone D
1 to J
1 rearrangements (Fig. 3 a).
|
The DV105S1 (V
5) gene segment rearranges by inversion and, therefore, a nongermline probe 1 hybridizing
band should be generated by the reciprocal product of a
DV105S1 to D
1 rearrangement. Furthermore, this band
would likely be of a different size than the probe 4 hybridizing band generated by the same rearrangement. Hybridomas F1D.17, 23, 32, and 61 all have 9-kb BglII probe 1 hybridizing bands (Fig. 3 a, data not shown). None of these
hybridomas has a 9-kb probe 4 hybridizing BglII band, and
each was found to have a DV105S1 to J
1 rearrangement
by PCR analysis (Table 2). Finally, V
to D
rearrangements by V
gene segments other than DV105S1 will result in loss of probe 1 hybridizing bands and generation of a
non-germline probe 3 hybridizing band that should be similar in size to the band generated by probe 4 when probing
BglII-digested DNA. In this regard F1D.68 has a 3.5-kb
BglII band that hybridizes to probes 3 and 4 and was found
to have a V
to D
2 rearrangement by PCR analysis (Fig.
3 a, Table 1).
|
These Southern blot analyses revealed that, of the 27 
T cell hybridomas analyzed, all had complete V(D)J
rearrangements on one allele (Fig. 3, a and b, Tables 1 and 2.
On the other allele, 19 hybridomas also had complete
V(D)J
rearrangements, one had a D
1D
2 rearrangement, one had a VD
2 rearrangement and 6 had D
1J
1
rearrangements (Fig. 3 a, Table 1). In addition, the J
2
gene segment was used in only one rearrangement (Fig. 3
b, Table 1).
Rearrangements in 
T Cell Hybridomas.
Using primers that should recognize the members of the
11 known mouse V
gene families in conjunction with
primers that were just downstream of J
1 or J
2, PCR
analysis was carried out on all hybridomas to determine V
gene segment usage (Tables 1 and ;reference2. By this
analysis none of the hybridomas analyzed gave more than
two distinct PCR products (data not shown). PCR products from the 19 hybridomas that had two complete
V(D)J
rearrangements were cloned and sequenced. None
of the V(D)J
rearrangements isolated used known V
pseudogenes (43). Two distinct rearrangements were isolated from 16 of the 19 hybridomas determined to have two V(D)J
rearrangements. All hybridomas had at least
one in-frame V(D)J
rearrangement except for F1D.64 in
which only a single out of frame V(D)J
rearrangement was
isolated (Table 2). The other allele of this hybridoma must
have an in-frame V(D)J
rearrangement, that was undetected by this analysis, as it expresses a TCR
chain (data not
shown). Only a single in-frame rearrangement was isolated
from F1D.36 and F1D.91. The inability to detect more than a single rearrangement in these hybridomas could be
due to the use of novel V
gene segments unable to be detected by the primer set used in this analysis. Alternatively,
these hybridomas may have two rearrangements involving
members of the same V
gene family that were not both
detected upon nucleotide sequence analysis. Significantly,
analyses of the 17 hybridomas with two defined V(D)J
joins revealed that 6 had two in-frame rearrangements, demonstrating that assembly of TCR
variable region
genes does not exhibit allelic exclusion (Table 2).
| |
Discussion |
|---|
|
|
|---|
To determine if assembly of TCR
variable region
genes is regulated in the context of allelic exclusion, we
have analyzed a panel of 27 clonal hybridomas derived
from mouse splenic 
T cells. Of the 17 hybridomas with
defined V(D)J
rearrangements on both alleles, 6 (35%)
have two in-frame rearrangements. This demonstrates that
TCR
variable region gene assembly does not exhibit allelic exclusion. Although this percentage is higher than the
20% (see Materials and Methods for calculations), which would be expected in the absence of allelic exclusion, this
difference is not statistically significant (P > 0.10). Two
human 
T cell clones with in-frame TCR
rearrangements on both alleles have been described previously (33,
45). However, given the number of cells analyzed in these
studies, it was not possible to determine whether these
clones represented rare events or a general lack of TCR
allelic exclusion. As TCR
rearrangements do not exhibit allelic exclusion, failure of TCR
allelic exclusion further increases the possibility that a single 
T cell will express two or more distinct 
TCRs (7).
It is possible that one of the TCR
rearrangements in
each of the six cells with two in-frame rearrangements encodes for a TCR
chain that cannot be expressed on the
surface of the cell and therefore would not signal a block of
further TCR
rearrangements. This may occur, for example, if the TCR
chain were not able to pair with a
TCR
chain or a component of a 
pre-TCR, if such a
receptor exists. In this regard, it has recently been shown that 2-4% of peripheral B cells have two in-frame IgH rearrangements but that only one encodes for an IgH chain
that is capable of forming a pre-B cell receptor (22). Our
data is more consistent with the notion that assembly of
TCR
variable region genes exhibits properties of allelic
inclusion as the percentage of 
T cell hybridomas with
two in-frame TCR
rearrangements is in agreement with
the percentage expected in the absence of allelic exclusion. Furthermore, this percentage is similar to that of 
T cells with two in-frame rearrangements at the TCR
locus,
which also exhibits allelic inclusion (3).
It has been proposed for the IgH locus (and by analogy
for the TCR
locus) that the precise ordering of variable
gene segment rearrangement during lymphocyte development may be important for effecting allelic exclusion (14).
In both of these loci, D to J rearrangement occurs on both
alleles before V to DJ rearrangement. Presumably V to DJ
rearrangement proceeds initially on one allele, at which
point the rearrangement is "tested." If it encodes a protein
that can be expressed, signals are generated that prevent further V to DJ rearrangements on the other allele. In accordance with this model, the expected number of B and
T cells have V(D)J/DJ configured rearrangements of their
IgH and TCR
alleles, respectively (3, 10).
Unlike the IgH and TCR
loci, assembly of TCR
variable gene segments is not ordered during development,
and we now show that the TCR
locus is not regulated in
the context of allelic exclusion. However, the finding that
many 
T cells have incomplete TCR
rearrangements
demonstrates that rearrangement is frequently terminated
before completion. The events that lead to termination of
TCR
rearrangement are not known. Thymic 
T cells
do not express RAG-1 or RAG-2, and it is possible, as
proposed for TCR
rearrangement, that down regulation
of RAG expression leads to termination of TCR
rearrangement (30, 46). Termination of TCR
rearrangement, by whatever mechanism, may be part of a developmental program that is independent of TCR
expression. Alternatively, rearrangement may cease upon TCR
expression, and failure of allelic exclusion may be due to the
unordered simultaneous rearrangement of TCR
alleles.
| |
Footnotes |
|---|
Address correspondence to Frederick W. Alt, Howard Hughes Medical Institute, Children's Hospital, Longwood Ave., Boston, MA 02115. Phone: 617-355-7290; Fax: 617-730-0432; E-mail: alt{at}rascal.med.harvard.edu
Received for publication 28 July 1998.
B.P. Sleckman's present address is Department of Pathology, Washington University School of Medicine, 660 S. Euclid Ave., St. Louis, MO 63110.We thank F. Livak and D. Schatz for providing us with probes and C.H. Bassing for critical review of the manuscript.
This work is supported by the Howard Hughes Medical Institute and by National Institutes of Health grants AI20047 (F.W. Alt) and AI01297-01 (B.P. Sleckman). B.P. Sleckman is a recipient of a Career Development Award in the Biomedical Sciences from the Burroughs Wellcome Fund.
Abbreviations used in this paper BW, BW-1100.129.237; D, diversity; DN, double negative; DP, double positive; H, heavy; J, joining; L, light; RAG, recombinase activating gene; V, variable.
| |
References |
|---|
|
|
|---|
| 1. | Sleckman, B.P., J.R. Gorman, and F.W. Alt. 1996. Accessibility control of antigen-receptor variable-region gene assembly: role of cis-acting elements. Annu. Rev. Immunol. 14: 459-481 [Medline]. |
| 2. | Okada, A., and F.W. Alt. 1994. Mechanisms that control antigen receptor variable region gene assembly. Sem. Immunol. 6: 185-196 [Medline]. |
| 3. |
Malissen, M.,
J. Trucy,
E. Jouvin-Marche,
P.-A. Cazenave,
R. Scollay, and
B. Malissen.
1992.
Regulation of TCR and
gene allelic exclusion during T cell development.
Immunol.
Today.
13:
315-322
[Medline].
|
| 4. | Alt, F.W., V. Enea, A.L. Bothwell, and D. Baltimore. 1980. Activity of multiple light chain genes in murine multiple myeloma cells producing a single, functional light chain. Cell. 21: 1-12 [Medline]. |
| 5. |
Casanova, J.-L.,
P. Romero,
C. Widmann,
P. Kourilsky, and
J.L. Maryanski.
1991.
T cell receptor genes in a series of class
I major histocompatibility complex-restricted cytotoxic T
lymphocyte clones specific for Plasmodium berghei nonapeptide: Implications for T cell allelic exclusion and antigen-specific repertoire.
J. Exp. Med.
174:
1371-1383
|
| 6. |
Padovan, E.,
G. Casorati,
P. Dellabona,
S. Meyer,
M. Brockhaus, and
A. Lanzavecchia.
1993.
Expression of two T cell
receptor chains: dual receptor T cells.
Science.
262:
422-424
|
| 7. |
Davodeau, F.,
M.-A. Peyrat,
I. Houde,
M.-M. Hallet,
G. De
Libero,
H. Vie, and
M. Bonneville.
1993.
Surface expression
of two distinct functional antigen receptors on human ![]() T
cells.
Science.
260:
1800-1802
|
| 8. | Coleclough, C., R.P. Perry, K. Karjalainen, and M. Weigert. 1981. Aberrant rearrangements contribute significantly to allelic exclusion of immunoglobulin gene expression. Nature. 290: 372-378 [Medline]. |
| 9. | Lansford, R., A. Okada, J. Chen, E.M. Oltz, T.K. Blackwell, F.W. Alt, and G. Rathbun. Mechanism and control of immunoglobulin gene rearrangement. In Molecular Immunology-Frontiers in Molecular Biology. 2nd edition. D.B. Hames, and D.M. Glover, editors. IRL Press, New York. 1-100. |
| 10. |
ten Boekel, E.,
F. Melchers, and
A. Rolink.
1995.
The status
of Ig rearrangements in single cells from different stages of B
cell development.
Int. Immunol.
7:
1013-1019
|
| 11. |
Wabl, M., and
C. Steinberg.
1982.
A theory of allelic exclusion for the immunoglobulin genes.
Proc. Natl. Acad. Sci.
USA.
79:
6976-6978
|
| 12. | Sonoda, E., Y. Pewzner-Jung, S. Schwers, S. Taki, S. Jung, D. Eilat, and K. Rajewsky. 1997. B cell development under the condition of allelic inclusion. Immunity. 6: 225-234 [Medline]. |
| 13. | Alt, F.A., N. Rosenberg, S. Lewis, E. Thomas, and D. Baltimore. 1981. Organization and reorganization of immunoglobulin genes in A-MuLV-transformed cells: Rearrangement of heavy but not light chain genes. Cell. 27: 381-390 [Medline]. |
| 14. | Alt, F.W., G.D. Yancopoulos, T.K. Blackwell, C. Wood, E. Thomas, M. Boss, R. Coffman, N. Rosenberg, S. Tonegawa, and D. Baltimore. 1984. Ordered rearrangement of immunoglobulin heavy chain variable region genes. EMBO (Eur. Mol. Biol. Organ.) 3: 1209-1219 [Medline]. |
| 15. |
Rusconi, S., and
G. Kohler.
1985.
Transmission and expression of a specific pair of rearranged immunoglobulin µ and genes in a transgenic mouse line.
Nature.
314:
330-334
[Medline].
|
| 16. | Weaver, D., F. Costantini, T. Imanishi-Kari, and D. Baltimore. 1985. A transgenic immunoglobulin mu gene prevents rearrangement of endogenous genes. Cell. 42: 117-127 [Medline]. |
| 17. |
Nussenzweig, M.C.,
A.C. Shaw,
E. Sinn,
D.B. Danner,
K.L. Holmes,
H.C. Morse III, and
P. Leder.
1987.
Allelic exclusion in mice that express the membrane form of immunoglobulin µ.
Science.
236:
816-819
|
| 18. |
Storb, U.,
C. Pinkert,
B. Arp,
P. Engler,
K. Gollahon,
J. Manz,
W. Brady, and
R. Brinster.
1986.
Transgenic mice
with µ and encoding anti-phosphorylcholine antibodies.
J.
Exp. Med.
164:
627-638
|
| 19. |
Uematsu, Y.,
S. Ryser,
Z. Dembic,
P. Borgulya,
P. Krimpenfort,
A. Berns,
H. von Boehmer, and
M. Steinmetz.
1988.
In transgenic mice the introduced functional T cell receptor gene prevents expression of endogenous genes.
Cell.
52:
831-841
[Medline].
|
| 20. | Loffert, D., A. Ehlich, W. Muller, and K. Rajewsky. 1996. Surrogate light chain expression is required to establish heavy chain allelic exclusion during B cell development. Immunity. 4: 133-144 [Medline]. |
| 21. | Kitamura, D., and K. Rajewsky. 1992. Targeted disruption of µ chain membrane exon causes loss of heavy-chain allelic exclusion. Nature. 356: 154-156 [Medline]. |
| 22. | ten Boekel, E., F. Melchers, and A.G. Rolink. 1998. Precursor B cells showing H chain allelic inclusion display allelic exclusion at the level of pre-B cell receptor surface expression. Immunity. 8: 199-208 [Medline]. |
| 23. | Aifantis, I., J. Buer, H. von Boehmer, and O. Azogui. 1997. Essential role of the pre-T cell receptor in allelic exclusion. Immunity. 7: 601-608 [Medline]. |
| 24. |
Chien, Y.-H.,
M. Iwashima,
K.B. Kaplan,
J.F. Elliot, and
M.M. Davis.
1987.
A new T-cell receptor gene located
within the locus and expressed early in T cell differentiation.
Nature.
327:
677-682
[Medline].
|
| 25. |
Satyanarayana, K.,
S. Hata,
P. Devlin,
M.C. Roncarolo,
J.E. De Vries,
H. Spits,
J.L. Strominger, and
M.S. Krangel.
1988.
Genomic organization of the human T-cell antigen-receptor
/ locus.
Proc. Natl. Acad. Sci. USA.
85:
8166-8170
|
| 26. |
Fehling, H.J., and
H. von Boehmer.
1997.
Early ![]() T cell
development in the thymus of normal and genetically altered
mice.
Curr. Opin. Immunol.
9:
263-275
[Medline].
|
| 27. | Willerford, D.M., W. Swat, and F.W. Alt. 1996. Developmental regulation of V(D)J recombination and lymphocyte differentiation. Curr. Opin. Gen. Dev. 6: 603-609 [Medline]. |
| 28. | Seboun, E., N. Joshi, and S. Hauser. 1992. Haplotypic origin of beta-chain genes expressed by human T-cell clones. Immunogenetics. 36: 363-368 [Medline]. |
| 29. |
Marolleau, J.-P.,
J.D. Fondell,
M. Malissen,
J. Trucy,
E. Barbier,
K.B. Marcu,
P.-A. Cazenave, and
D. Primi.
1988.
The
joining of germ-line V to J genes replaces the preexisting
V -J complexes in a T cell receptor , positive T cell line.
Cell.
55:
291-300
[Medline].
|
| 30. |
Borgulya, P.,
H. Kishi,
Y. Uematsu, and
H. von Boehmer.
1992.
Exclusion and inclusion of and T cell receptor alleles.
Cell.
69:
529-537
[Medline].
|
| 31. |
Kang, J., and
D.H. Raulet.
1997.
Events that regulate differentiation of ![]() TCR+ and ![]() TCR+ T cells from a common precursor.
Semin. Immunol.
9:
171-179
[Medline].
|
| 32. |
Chien, Y.-H.,
M. Iwashima,
D.A. Wettstein,
K.B. Kaplan,
J.F. Elliot,
W. Born, and
M.M. Davis.
1987.
T-cell receptor
gene rearrangements in early thymocytes.
Nature.
330:
722-727
[Medline].
|
| 33. | Migone, N., S. Padovan, C. Zappador, C. Glachino, M. Bottaro, G. Matullo, C. Carbonara, G. De Libero, and G. Casorati. 1995. Restriction of the T-cell receptor V delta gene repertoire is due to preferential rearrangement and is independent of antigen selection. Immunogenetics. 42: 323 [Medline]. |
| 34. |
Sleckman, B.P.,
C.G. Bardon,
R. Ferrini,
L. Davidson, and
F.W. Alt.
1997.
Function of the TCR enhancer in ![]() and
![]() T cells.
Immunity.
7:
505-515
[Medline].
|
| 35. | White, J., M. Blackman, J. Bill, J. Kappler, P. Marrack, D. Gold, and W. Born. 1989. Two better cell lines for making hybridomas expressing specific T cell receptors. J. Immunol. 143: 1822-1825 [Abstract]. |
| 36. |
Chen, J.,
R. Lansford,
V. Stewart,
F. Young, and
F.W. Alt.
1993.
RAG-2-deficient blastocyst complementation: an assay
of gene function in lymphocyte development.
Proc. Natl.
Acad. Sci. USA.
90:
4528-4532
|
| 37. |
Laird, P.W.,
A. Zijderveld,
K. Linders,
M.A. Rudnicki,
R. Jaenisch, and
A. Berns.
1991.
Simplified mammalian DNA
isolation procedure.
Nucleic Acids Res.
19:
4293
|
| 38. | Yancopoulos, G.D., T.K. Blackwell, H. Suh, L. Hood, and F.W. Alt. 1986. Introduced T cell receptor variable region gene segments recombine in pre-B cells: evidence that B and T cells use a common recombinase. Cell. 44: 251-259 [Medline]. |
| 39. |
Korman, A.J.,
J. Maruyama, and
D. Raulet.
1989.
Rearrangement by inversion of a T-cell receptor variable region
gene located 3' of the constant region gene.
Proc. Natl.
Acad. Sci. USA.
86:
267-271
|
| 40. |
Winoto, A., and
D. Baltimore.
1989.
Separate lineages of T
cells expressing the ![]() and ![]() receptors.
Nature.
338:
430-432
[Medline].
|
| 41. |
Livak, F.,
H.T. Petrie,
I.N. Crispe, and
D.G. Schatz.
1995.
In-frame TCR gene rearrangements play a critical role in
the ![]() /![]() T cell lineage decision.
Immunity.
2:
617-627
[Medline].
|
| 42. |
Elliott, J.F.,
E.P. Rock,
P.A. Patten,
M.M. Davis, and
Y.-H. Chen.
1988.
The adult T-cell receptor -chain is diverse and
distinct from that of fetal thymocytes.
Nature.
331:
627-631
[Medline].
|
| 43. | Arden, B., S.P. Clark, D. Kabelitz, and T.W. Mak. 1995. Mouse T-cell receptor variable gene segment families. Immunogenetics. 42: 501-530 [Medline]. |
| 44. | Sleckman, B.P., C.H. Bassing, C.G. Bardon, A. Okada, B. Khor, J.-C. Bories, R. Monroe, and F.W. Alt. 1998. Accessibility control of variable region gene assembly during T cell development. Immunol. Rev. In press. |
| 45. |
Krangel, M.S.,
H. Yssel,
C. Brocklehurst, and
H. Spits.
1990.
A distinct wave of human T cell receptor / lymphocytes in
the early fetal thymus: evidence for controlled gene rearrangement and cytokine production.
J. Exp. Med.
172:
847-859
|
| 46. |
Livak, F.,
A. Wilson,
H.R. MacDonald, and
D. Schatz.
1997.
![]() lineage-committed thymocytes can be rescued by the ![]()
T cell receptor (TCR) in the absence of TCR chain.
Eur.
J. Immunol.
27:
2948-2958
[Medline].
|
This article has been cited by other articles:
| ||||||||||||||||||||||||