J. Exp. Med.,
Volume 188, Number 7, October 5, 1998 1369-1373
The Interleukin 2 Receptor
Chain/CD25 Promoter
Is a Target for Nuclear Factor of Activated T Cells
By
Kai
Schuh,*
Thomas
Twardzik,*
Burkhard
Kneitz,
Jörg
Heyer,*
Anneliese
Schimpl,
and
Edgar
Serfling*
From the * Institute of Pathology, and the
Institute of Virology and Immunobiology, University of
Würzburg, D-97080 Würzburg, Germany
 |
Abstract |
The expression of the murine interleukin (IL)-2 receptor
chain/CD25 is strongly induced at
the transcriptional level after T cell activation. We show here that nuclear factor of activated T
cell (NF-AT) factors are involved in the control of CD25 promoter induction in T cells. NF-ATp and NF-ATc bind to two sites around positions
585 and
650 located upstream of the
proximal CD25 promoter. Immediately 3' from these NF-AT motifs, nonconsensus sites are
located for the binding of AP-1-like factors. Mutations of sites that suppress NF-AT binding
impair the induction and strong NF-ATp-mediated transactivation of the CD25 promoter in T cells. In T lymphocytes from NF-ATp-deficient mice, the expression of CD25 is severely
impaired, leading to a delayed IL-2 receptor expression after T cell receptor (TCR)/CD3 stimulation. Our data indicate an important role for NF-AT in the faithful expression of high affinity IL-2 receptors and a close link between the TCR-mediated induction of IL-2 and IL-2 receptor
chain promoters, both of which are regulated by NF-AT factors.
Key words:
interleukin 2 receptor;
nuclear factor of activated T cells;
transcription factors;
T cells;
NF-AT factors
 |
Introduction |
The high affinity IL-2 receptor consists of three individual polypeptides, the
,
, and
chains. Although the
and
chains are shared by other lymphokine receptors,
the
chain (CD25) is restricted to the IL-2 receptor, and is
expressed by a variety of lymphoid cells (for review see reference 1). The induction of CD25 in T cells is controlled
at the transcriptional level through two DNA sequence elements, a proximal promoter/enhancer spanning the nucleotides between positions
54 and
584 in the mouse and
64 and
276 in humans, and a distal enhancer spanning ~80 nucleotides around position
1350 in the mouse and
3750 (or
4150, according to another nomenclature) in
the human CD25 gene (2). The activity of the promoter
is rapidly induced by TCR-mediated signals or IL-1, and is
controlled by an array of transcription factors, in particular
by nuclear factor (NF)-
B, Elf-1, SRF, and HMG I(Y).
The induction of the distal enhancer is controlled by IL-2,
which induces signal transducer and activator of transcription (Stat)5, a member of the family of Stat transcription
factors. Stat5 binds in concert with Elf-1, HMG I(Y), and
GATA factors to multiple sites of the distal enhancer and
contributes to its IL-2-mediated full expression in activated
peripheral T lymphocytes (4).
Nuclear factor of activated T cell (NF-AT) factors comprise a family of transcription factors that contribute to the
induced expression of numerous lymphokine and receptor
genes in T cells. Similar to NF-
B factors, the nuclear
translocation and activity of NF-AT factors is stimulated by
TCR-mediated signals (for review see reference 7). The
DNA-binding domains of NF-AT and NF-
B/Rel factors
share a common architecture (8) and, therefore, recognize overlapping DNA sequence motifs. These common properties between NF-AT and NF-
B (a major regulator of the
CD25 promoter), and reports on the inhibition of CD25
expression by cyclosporin A (9) (an inhibitor of phosphatase calcineurin and, therefore, of nuclear translocation
of NF-AT; reference 7), prompted us to investigate whether
NF-AT factors participate in CD25 promoter control. We
show here that NF-ATp and NF-ATc bind to two sites located immediately upstream of the proximal CD25 promoter. Mutations within the NF-AT sites that suppress
NF-AT binding impair CD25 promoter induction. Accordingly, the induction of CD25 is markedly delayed in T
cells from NF-ATp-deficient mice. These findings implicate an important role for NF-AT factors in the inducible expression of high affinity IL-2 receptors after T cell activation.
 |
Materials and Methods |
Cell Culture, Construction, and Transfection of CD25 Promoter Luciferase Plasmids.
Murine El4 T thymoma cells and human Jurkat
T leukemia cells were grown in RPMI medium containing 5%
FCS. 2 × 107 cells were transfected using the DEAE dextran protocol with 2.5 µg DNA of the CD25 promoter-luciferase reporter constructs alone or 0.5-2.5 µg DNA of reporter constructs
(as indicated in the figure legends) along with 2 µg of a pLGP3-based vector expressing full-length murine NF-ATp (NF-AT1-C;
reference 10) or an RSV-LTR vector expressing human NF-ATc. Human 293 embryonic kidney cells were cultured in
DMEM and transfected using a calcium phosphate transfection
protocol. The luciferase reporter gene construct contains the
wild-type murine CD25 promoter spanning the nucleotides up
to position
2556 (4). Mutations in one or both of the NF-ATp binding sites around positions
585 and
650 were introduced
into the promoter fragment from +1 to
800 using the
QuikChangeTM site-directed mutagenesis kit (Stratagene Corp.,
La Jolla, CA) according to the manufacturer's instructions.
The following oligonucleotides were used for the mutagenesis
of NF-AT sites:
(i) (
667) GCTAGACTTAAAATCTATCATTGCAGCTGTAAACAC (
632)
CGATCTGAATTTTAGATAGTAACGTCGACATTTGTG; and
(ii) (
596) CCCACACCCATGATACTATGAATCGTGCATCAGAG (
562)
GGGTGAGGGTACTATGATACTTAGCACGTAGTCTC
The underlined nucleotides indicate the mutations.
Immunofluorescence and Flow Cytometry.
For Ab stainings, 2-8 × 105 cells were incubated on ice with mAbs at saturating concentrations. Fluorescein- and PE-labeled mAbs (Pharmingen, San
Diego, CA) were used for two- and three-color immunofluorescence. For three-color flow cytometry, cells were stained first with
biotinylated mAbs (PharMingen) for 15 min and were subsequently incubated with streptavidin-Red670 (GIBCO BRL, Eggenstein, Germany) and FITC- and PE-labeled mAbs for 15 min.
Results obtained after analysis on a FACScan® flow cytometer
(Becton Dickinson, Mountain View, CA) using Lysys II software
(Becton Dickinson) are shown as log dot-plots or histograms.
DNase I Footprint Protection Assays and EMSAs.
In DNase I
footprint protection assays, end-labeled DNA probes were prepared using [
-32P]ATP and polynucleotide kinase. 104 cpm
(~0.2 ng) of the following DNA fragments from the murine CD25 promoter (4) were used: (a) the HindIII-SacII fragment spanning the nucleotides from position +94 to
268; and (b) the SacII-BglII fragment spanning the nucleotides from
268 to
801. Fragment (a) was recut with EspI, and fragment (b) with
DraI generating DNA fragments of ~150-300 bp. These were
incubated for 60 min with a bacterially expressed glutathione
S-transferase (GST)-NF-ATp protein (11) containing the DNA-binding domain of murine NF-ATp. The samples were processed
and fractionated on 6% polyacrylamide, 42% urea-sequencing gels.
Electromobility shift assays (EMSAs) were performed as previously described (11), using 2 µg nuclear proteins and 0.5 µg poly
[d(I-C)]. In supershift EMSAs, 0.5 µg of either an NF-ATp-specific Ab (Cat. no. 06-348; UBI) or an NF-ATc-specific mAb
(7A6) (12) were added to the incubations. When the DNA binding of GST-NF-ATp was tested, 0.5-1.5 µg of bacterial proteins
prepared by affinity column chromatography (11) were incubated
along with 0.5 µg poly [d(I-C)]. The following oligonucleotides
were used as probes:
(iii) (
596)gatcCCCACACCCATGGAACTATGAATCGTG (
571)
GGGTGTGGGTACCTTGATACTTAGCACctag;
(iv) (
663)gatcGACTTAAAATCTTCCATTGCAGCTGTA (
635)
CTGAATTTTAGAAGGTAACGTCGACATctag; and
(v) (
667)GCTAGACTTAAAATCTTCCATTGCAGCTGTAAACAC (
632)
CGATCTGAATTTTAGAAGGTAACGTCGACATTTGTG
The small letters indicate linker nucleotides.
 |
Results and Discussion |
To determine whether the CD25 promoter is a target
for NF-AT, we cotransfected a CD25 promoter-driven luciferase reporter gene with NF-ATp- and NF-ATc-specific expression vectors into El4 T and 293 cells. Treatment
of 293 cells with TPA plus ionomycin (T+I) led to a <2-fold, and treatment of El4 cells with T+Con A led to an
8-9-fold, induction of activity of CD25 promoter spanning the nucleotides up to position
2556 (4), and to a 12-fold induction of a shorter CD25 promoter reaching up to
800. Cotransfection of an NF-ATp expression vector
into El4 cells resulted in a strong, 40-fold induction of activity of the longer CD25 promoter and in an up to 60-fold
induction of the shorter CD25 promoter fragment after
T+Con A treatment of cells (Fig. 1). Cotransfection with the NF-ATc vector gave rise to only a slight increase in
promoter activity. In 293 cells, the overexpression of both
NF-AT factors resulted in a six- to ninefold increase in
CD25 promoter activity (Fig. 1).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
NF-ATp transactivates the murine CD25 promoter in T
cells. 2.5 µg DNA of luciferase reporter gene constructs controlled by
murine CD25 promoters up to position 2556 (wt-2556) and 800 (wt-800) were transfected into murine El4 T thymoma cells or human embryonic 293 kidney cells, along with an empty RSV-based expression vector
or vectors expressing NF-ATp (10) or NF-ATc. The cells were induced
as indicated for 18 h. To calculate the extent of induction, the activity of
the CD25 wild-type promoter in nonstimulated cells was used as a reference point (onefold).
|
|
To demonstrate the binding of NF-ATp to the CD25
promoter, GST-NF-ATp encoding its DNA-binding domain was incubated with DNA fragments containing the
first 800 bp of the promoter region in DNase I footprint
protection assays. Two prominent footprints were detected, spanning the nucleotides from
577 to
587 and
639 to
658, respectively (Fig. 2 A). These comprise the
NF-AT "core" binding sequence TGGAA (7) in opposite
orientations (Fig. 2 B). When probes of these oligonucleotides were incubated with GST-NF-ATp in EMSAs,
both probes were bound by NF-ATp, whereas a third
probe spanning the unprotected nucleotides from
619 to
636 was unable to bind (Fig. 2 C, lanes 13-15). Using
nuclear proteins from murine splenocytes, the generation
of typical inducible NF-AT complexes was detected with
the
639/
658 probe (Fig. 2 C, lanes 1-6) and, although
far more weakly, with the
577/
587 probe (Fig. 2 C,
lanes 7-12). The generation of these complexes was enhanced
after induction of cells with T+I (lanes 1, 2, 7, and 8) and
efficiently competed with a 100-fold molar excess of the distal IL-2 NF-AT site (Fig. 2 C, lanes 6 and 12). Moreover, the complexes were supershifted in EMSAs using NF-ATp- and NF-ATc-specific Abs (lanes 3, 4, 9, and 10).

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 2.
Binding of NF-AT
to the CD25 promoter. (A)
DNase I footprint protection assay. A CD25 promoter probe
spanning the nucleotides from
548 to 804 was incubated
with 3 and 5 µg BSA (lanes 3 and 4) or 1-5 µg GST-NF-ATp
protein (lanes 5-9). The NF-ATp-specific footprints are indicated. G and G+A, chemical
sequencing reactions. (B) Sequences of footprint regions.
The footprints are indicated in
brackets. The arrows indicate the
direction of TGGAA NF-AT
"core" motifs. The TPA responsive element-like sequence motifs 3' from the NF-AT motifs
are boxed. (C) EMSAs with the
NF-AT sites. In lanes 1-12, nuclear proteins from murine splenocytes are shown, and in lanes
13-15, GST-NF-ATp was used
with the 639/ 658 (lanes 1-6
and 13) and 577/ 587 probes
(lanes 7-12 and 15). In lane 14, a
probe of the 610/ 636 site
was used as a control. 2 µg of
nuclear proteins from uninduced splenocytes ( ) or splenocytes induced for 2 h with T+I
(+) were incubated in the absence or presence of 0.5 µg NF-ATc- or NF-ATp-specific Abs,
or in the presence of a 200-fold
molar excess of homologous unlabeled probes or distal IL-2 NF-AT site as indicated. Note that the autoradiograph of lanes 1-6 was exposed for 16 h, and that of lanes 7-12 for 3 d. NS, nonspecific complex. Free
probes are cut off. (D) EMSAs of the 639/ 658 site using nuclear proteins from Jurkat cells. A probe of the 639/ 658 site was incubated with 2 µg
of nuclear proteins from Jurkat cells treated with T+I in the absence or presence of 100 ng/ml cyclosporin A (CsA). For competition the following
DNAs were used: 5-50 ng of the cold 639/ 658 site and the distal IL-2 NF-AT site, or 10 and 50 ng of the proximal IL-2 octamer site (11) and a consensus AP-1 site. In lanes 16 and 17, 0.5 µg of NF-AT-specific Abs were added. In lanes 18-20, a 632/ 667 probe mutated in the NF-AT site (see
oligonucleotide a in Materials and Methods) was incubated without or with NF-AT-specific Abs.
|
|
The
639/
658 site corresponds to a high-affinity NF-AT binding site. This could be seen best in EMSA competition assays comparing the binding of NF-AT factors in
nuclear protein preparations from T+I-induced Jurkat cells
to this site and the distal NF-AT site of the murine IL-2
promoter (Fig. 2 D). Although 5-10 ng of the
639/
658
site was sufficient to suppress almost all NF-AT binding, 10-50 ng of the distal IL-2 NF-AT site was necessary to see
the same effect (Fig. 2 D, lanes 6-11). 50 ng of an AP-1
site was also able to suppress NF-AT complex formation,
whereas the same amount of the upstream promoter site,
i.e., an efficient octamer but poor AP-1 site from the IL-2
promoter (11), was without effect on factor binding (Fig. 2
D, lanes 12-15). In contrast to the
639/
658 site, the
577/
587 NF-ATp binding site is a low-affinity NF-AT
site (Fig. 2 C, lanes 7-12; note that lanes 7-12 were exposed five times longer than lanes 1-6).
To demonstrate a functional role for the two NF-ATp
sites, we introduced mutations into the NF-AT motifs of
each site, or into both sites, in the context of the 800-bp
wild-type CD25 promoter fragment. These mutations led
to a loss of NF-AT binding in EMSAs using nuclear proteins from induced Jurkat cells (see Fig. 2 D, lanes 18-20)
or GST-NF-ATp (data not shown). When the mutated CD25 promoter/luciferase constructs were transfected into
El4 T cells alone or with an NF-ATp expression vector
their induction was severely impaired compared with the
wild-type promoter. The T+Con A-mediated 16-fold induction of the 800-bp CD25 promoter fragment was almost abolished (Fig. 3 A) and its >25-fold transactivation by NF-ATp was reduced to a 2-3-fold increase for the
mutated promoter (Fig. 3 B).

View larger version (17K):
[in this window]
[in a new window]

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
The NF-ATp sites contribute to the induction of CD25 promoter. (A) Mutations within the NF-ATp sites that suppress NF-AT binding interfere with the T+Con A-mediated CD25 promoter induction in El4 cells. 2.5 µg of luciferase constructs containing the wild-type CD25 promoter up
to 800 bp or a promoter with mutations in the 658/ 639 (mut. 1), the 587/ 577 site (mut. 2), or in both sites (mut. 1+2) was transfected into El4
cells that were induced for 12 h. (B) Mutations of NF-AT sites suppress the NF-ATp-mediated transactivation of the CD25 promoter. 0.5 µg of the
CD25 luciferase constructs was cotransfected with an NF-ATp expression vector into El4 cells that were stimulated for 12 h. To calculate the extent of
induction, the activity of the CD25 wild-type promoter in nonstimulated cells was used as a reference point (onefold).
|
|
The importance of NF-ATp sites for the CD25 expression is underlined by defects in the CD25 surface expression on LN T cells from NF-ATp
/
mice established in
our laboratory (13). When LN T cells from wild-type mice
were stimulated with plate-bound
-CD3 Abs for 2-24 h
in vitro, a marked increase of CD25 surface expression was
detected after 6-12 h, which became even more pronounced after 24 h. Due to the strong stimulation of the
CD25 promoter by secreted IL-2 (2), >50% of T cells express large amounts of CD25 48 h after stimulation (Fig. 4).
On NF-ATp
/
LN T cells, CD25 expression was found to
be distinctly delayed, becoming clearly detectable only 24 h
after induction in spite of high, unimpaired IL-2 production
of NF-ATp
/
T cells (13). In addition, fewer cells expressed high levels of CD25 after induction for 48 h (Fig. 4).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4.
Impaired CD25 expression on NF-ATp / LN T cells. LN
T cells from NF-ATp+/+ and NF-ATp / mice (13) were treated with
plate-bound -CD3 mAb in vitro.
The cells were stained with mAbs
directed against murine CD25 (7D4;
PharMingen) and / -TCR (H57-597; PharMingen). The expression
of CD25 on / -TCR+ LN cells is
shown. The lowest panel shows a
comparison of CD25 expression on
NF-ATp+/+ and NF-ATp /
TCR+ LN cells stimulated for 24 h.
The dotted line indicates the isotype
control staining of LN cells.
|
|
The two NF-ATp binding sites are located near the
CD25 promoter and therefore appear to be involved in the
rapid induction of the murine CD25 gene in resting T
cells. The core sequences of these sites, TGGAA, differ
slightly from the AGGAAAA core motifs of the IL-2 and
IL-4 promoters and are the strongest NF-ATp binding sites
in the human GM-CSF enhancer (14). As indicated in Fig. 2 B, 7-9 bp 3' to the NF-AT motifs are situated TPA-
responsive element-like sequences that might allow the concerted binding of AP-1 and NF-AT. In EMSAs we detected
a specific binding of GST-c-Jun to both sites (data not
shown), but it remains to be shown which proteins of the
AP-1 family bind and regulate the CD25 promoter in vivo.
Finally, it should be pointed out that several properties of
NF-ATp
/
mice, such as the impaired clonal deletion of
T cells and expansion of lymphoid organs (13, 15, 16), are
shared by the mice deficient for IL-2 and IL-2 receptors
(17). We assume that the impaired CD25 expression
might contribute to the development of this phenotype in
NF-ATp
/
mice, which is reminiscent of other mice with
defects in the IL-2 signaling system.
 |
Footnotes |
Address correspondence to Edgar Serfling, Department of Molecular Pathology, Institute of Pathology, University of Würzburg, Josef-Schneider-Str. 2, D-97080 Würzburg, Germany. Phone: 49-931-201-34-29/95;
Fax: 49-931-201-34-40; E-mail: path015{at}mail.uni-wuerzburg.de
Received for publication 27 January 1998 and in revised form 29 July 1998.
The first two authors contributed equally to this paper.
We are indebted to Daniela Räth and Heidi Runknagel for excellent technical assistance. We wish to thank
Dr. M. Nabholz (Swiss Institute for Experimental Cancer Research, Epalinges, Switzerland) and Dr. A. Rao
(Center for Blood Research and Department of Pathology, Harvard Medical School, Boston, MA) for DNA
constructs.
This work was supported by grants from the Wilhelm-Sander-Stiftung (to E. Serfling) and the Deutsche
Forschungsgemeinschaft, SFBs 165 and 465 (to A. Schimpl and E. Serfling).
 |
References |
| 1.
|
Minami, J.,
T. Kono,
T. Miyazaki, and
T. Taniguchi.
1993.
The IL-2 receptor complex: its structure, function, and target
genes.
Annu. Rev. Immunol.
11:
245-268
[Medline].
|
| 2.
|
Sperisen, P.,
S.M. Wang,
E. Soldaini,
M. Pla,
C. Rusterholz,
P. Bucher,
P. Corthesy,
P. Reichenbach, and
M. Nabholz.
1995.
Mouse interleukin-2 receptor gene expression. Interleukin-1 and interleukin-2 control transcription via distinct cis-acting elements.
J. Biol. Chem.
277:
10743-10752
.
|
| 3.
|
John, S.,
R.B. Reeves,
J.-Y. Lin,
R. Child,
J.M. Leiden,
C.B. Thompson, and
W.J. Leonard.
1995.
Regulation of
cell-type-specific interleukin-2 receptor chain gene expression: potential role of physical interactions between Elf-1,
HMG-I(Y), and NF- B family proteins.
Mol. Cell. Biol.
15:
1786-1796
[Abstract].
|
| 4.
|
Serdobova, I.,
M. Pla,
P. Reichenbach,
P. Sperisen,
J. Ghysdael,
A. Wilson,
J. Freeman, and
M. Nabholz.
1997.
Elf-1
contributes to the function of the complex interleukin (IL)-
2-responsive enhancer in mouse IL-2 receptor gene.
J.
Exp. Med.
185:
1211-1221
[Abstract/Free Full Text].
|
| 5.
|
John, S.,
C.M. Robbins, and
W.J. Leonard.
1996.
An IL-2
response element in the human IL-2 receptor chain promoter is a composite element that binds Stat5, Elf-1, HMG-I(Y) and a GATA family protein.
EMBO (Eur. Mol. Biol. Organ.) J.
15:
5627-5635
[Medline].
|
| 6.
|
Lecine, P.,
M. Algarte,
P. Rameil,
C. Beadling,
P. Bucher,
M. Nabholz, and
J. Imbert.
1996.
Elf-1 and Stat5 bind to a
critical element in a new enhancer of the human interleukin-2 receptor chain.
Mol. Cell. Biol.
16:
6829-6840
[Abstract].
|
| 7.
|
Rao, A.,
C. Luo, and
P.G. Hogan.
1997.
Transcription factors of the NFAT family: regulation and function.
Annu. Rev.
Immunol.
15:
707-747
[Medline].
|
| 8.
|
Wolf, S.A.,
P. Zhou,
V. Dötsch,
L. Chen,
A. You,
S.N. Ho,
G.R. Crabtree,
G. Wagner, and
G.L. Verdine.
1997.
Unusual Rel-like architecture in the DNA-binding domain of
the transcription factor NF-ATc.
Nature.
385:
172-176
[Medline].
|
| 9.
|
Gauchat, J.-F.,
E.W. Khandjian, and
R. Weil.
1986.
Cyclosporin A prevents induction of the interleukin 2 receptor
gene in cultured murine thymocytes.
Proc. Natl. Acad. Sci.
USA.
83:
6430-6434
[Abstract/Free Full Text].
|
| 10.
|
Luo, C.,
E. Burgeon,
J.A. Carew,
P.G. McCaffrey,
T.M. Badalian,
W.S. Lane,
P.G. Hogan, and
A. Rao.
1996.
Recombinant NFAT1 (NFATp) is regulated by calcineurin in T
cells and mediates transcription of several cytokine genes.
Mol. Cell. Biol.
16:
3955-3966
[Abstract].
|
| 11.
|
Pfeuffer, I.,
S. Klein-Hessling,
A. Heinfling,
S. Chuvpilo,
C. Escher,
T. Brabletz,
B. Hentsch,
H. Schwarzenbach,
P. Matthias, and
E. Serfling.
1994.
Octamer factors exert a dual effect on the IL-2 and IL-4 promoters.
J. Immunol.
153:
5572-5585
[Abstract].
|
| 12.
|
Northrop, J.P.,
S.N. Ho,
L. Chen,
D.J. Thomas,
L.A. Timmerman,
G.P. Nolan,
A. Admon, and
G.R. Crabtree.
1994.
NF-AT components define a family of transcription factors
targeted in T-cell activation.
Nature.
369:
497-502
[Medline].
|
| 13.
|
Schuh, K.,
B. Kneitz,
J. Heyer,
F. Siebelt,
C. Fischer,
E. Jankevics,
E. Rüde,
E. Schmitt,
A. Schimpl, and
E. Serfling.
1997.
NF-ATp plays a prominent role in the transcriptional
induction of Th2-type lymphokines.
Immunol. Lett.
57:
171-175
[Medline].
|
| 14.
|
Cockerill, P.N.,
A.G. Bert,
F. Jenkins,
G.R. Ryan,
M.F. Shannon, and
M. A. Vadas.
1995.
Human granulocyte-macrophage colony-stimulating factor enhancer function is associated
with cooperative interactions between AP-1 and NFATp/c.
Mol. Cell. Biol.
15:
2071-2079
[Abstract].
|
| 15.
|
Hodge, M.R.,
A.M. Ranger,
F.C. de la Brousse,
T. Hoey,
M.J. Grusby, and
L.H. Glimcher.
1996.
Hyperproliferation
and dysregulation of IL-4 expression in NF-ATp-deficient
mice.
Immunity.
4:
397-405
[Medline].
|
| 16.
|
Xanthoudakis, S.,
J.P.B. Viola,
K.T.Y. Shaw,
C. Luo,
J.D. Wallace,
P.T. Bozza,
T. Curran, and
A. Rao.
1996.
An enhanced immune response in mice lacking the transcription
factor NFAT1.
Science.
272:
892-895
[Abstract].
|
| 17.
|
Kneitz, B.,
T. Herrmann,
S. Yonehara, and
A. Schimpl.
1995.
Normal clonal expansion but impaired Fas-mediated
cell death and anergy induction in interleukin-2-deficient
mice.
Eur. J. Immunol.
25:
2572-2577
[Medline].
|
| 18.
|
Willerford, D.M.,
J. Chen,
J.A. Ferry,
L. Davidson,
A. Ma, and
F.W. Alt.
1995.
Interleukin-2 receptor chain regulates
the size and content of the peripheral lymphoid compartment.
Immunity.
3:
521-530
[Medline].
|
| 19.
|
Suzuki, H.,
T.M. Kündig,
C. Furlonger,
A. Wakeham,
E. Timms,
T. Matsuyama,
R. Schmits,
J.L. Simard,
P.S. Ohashi,
H. Griesser, et al
.
1995.
Deregulated T cell activation and autoimmunity in mice lacking interleukin-2 receptor .
Science.
268:
1472-1476
[Abstract/Free Full Text].
|