The Journal of Experimental Medicine
Accuri Cytometers
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 151K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JEM
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Retter, M. W.
Right arrow Articles by Nemazee, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Retter, M. W.
Right arrow Articles by Nemazee, D.
Right arrowPubmed/NCBI databases
*Nucleotide
*Substance via MeSH
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Exp. Med., Volume 188, Number 7, October 5, 1998 1231-1238

Receptor Editing Occurs Frequently during Normal B Cell Development

By Marc W. Retter* and David Nemazee*Dagger

From the * National Jewish Medical and Research Center, Division of Basic Sciences, Department of Pediatrics, Denver, Colorado 80206; and the Dagger  University of Colorado Health Science Center, Department of Immunology, Denver, Colorado 80220

    Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Allelic exclusion is established in development through a feedback mechanism in which the assembled immunoglobulin (Ig) suppresses further V(D)J rearrangement. But Ig expression sometimes fails to prevent further rearrangement. In autoantibody transgenic mice, reactivity of immature B cells with autoantigen can induce receptor editing, in which allelic exclusion is transiently prevented or reversed through nested light chain gene rearrangement, often resulting in altered B cell receptor specificity. To determine the extent of receptor editing in a normal, non-Ig transgenic immune system, we took advantage of the fact that lambda  light chain genes usually rearrange after kappa  genes. This allowed us to analyze kappa  loci in IgMlambda + cells to determine how frequently in-frame kappa  genes fail to suppress lambda  gene rearrangements. To do this, we analyzed recombined Vkappa Jkappa genes inactivated by subsequent recombining sequence (RS) rearrangement. RS rearrangements delete portions of the kappa  locus by a V(D)J recombinase-dependent mechanism, suggesting that they play a role in receptor editing. We show that RS recombination is frequently induced by, and inactivates, functionally rearranged kappa  loci, as nearly half (47%) of the RS-inactivated Vkappa Jkappa joins were in-frame. These findings suggest that receptor editing occurs at a surprisingly high frequency in normal B cells.

Key words: receptor editing;  recombining sequence recombination;  immune tolerance;  B lymphocytes;  V(D)J rearrangements
    Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

The fact that virtually all B cells express a single H and L chain prompted many studies to elucidate the underlying mechanism. One process that clearly contributes to allelic exclusion is the imprecision of V(D)J rearrangement that generates a maximum of one in-frame rearrangement per three attempts (1), but more active feedback processes are also involved. Classic studies showing the ability of a H chain transgene (2, 3) or an L chain transgene (4, and for review see reference 5) to mediate feedback suppression of H and L chain rearrangements, respectively, established important paradigms that have been widely accepted. But in the case of L chain allelic exclusion, this paradigm was weakened by an increasing number of "exceptions", in which ongoing L chain rearrangement occurred despite expression of functional kappa  chain (6). Studies with autoantibody transgenic (Tg)1 mice suggested that many of the exceptions to the feedback regulation model of L chain allelic exclusion could be explained by postulating self-tolerance- induced receptor editing (10). In addition, recent in vitro studies (16) and analyses of autoantibody Ig knock-in mice (19, 20) have shown that L chain gene receptor editing can be an important mechanism of B cell tolerance. Despite these findings, it is unclear how frequently receptor editing is used for tolerance induction in normal, non-Ig Tg autoreactive B cells, in part because the extent of autoreactivity in the preselected B cell repertoire is unknown.

The organization of the kappa  locus, with arrangement of Vkappa genes in both sense and antisense transcriptional orientations, the absence of D region gene segments, and the presence of several Jkappa gene segments facilitates sequential, nested Vkappa -to-Jkappa rearrangement attempts (for review see reference 21). In developing B cells, these secondary rearrangements can both rescue receptor expression in cells that fail to assemble in-frame L chains (1, 22) and rescue autoreactive B cells from tolerance elimination by replacing rearranged kappa  genes with new ones that alter specificity (for review see reference 23). Another way that the organization of the kappa  locus promotes receptor editing is suggested by the existence of the conserved element known as recombining sequence (RS) in the mouse (or the homologous "kappa deleting element" in humans; reference 24). RS is located ~25 kb downstream of the Ckappa exon (25) and has no coding function (26), but undergoes V(D)J recombinase-dependent rearrangement that inactivates the kappa  locus by deletional rearrangements in cis (26) (see Fig. 1). In an autoantibody knock-in model system, RS rearrangements can inactivate functional kappa  genes (20), but the extent of RS-mediated receptor editing in normal B cells remains unknown.


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 1.   RS rearrangements inactivate and preserve Vkappa Jkappa joins. A rearranged, potentially functional kappa  locus (A) can be silenced by two types of RS recombination: Vkappa -RS (B) or Vkappa Jkappa -intron-RS (C). Type C retains the prior Vkappa Jkappa join, and the RS recombination event eliminates the known cis acting elements that are critical for efficient rearrangement and expression, thus freezing the locus from further Vkappa Jkappa recombination. Also shown are the intronic recombination sequence 1 (IRS1) (32), the intronic (iE) and 3' kappa (3'E) enhancers (35, 36), and the recombining sequence (RS) (27, 28) element. Probes IVS (1) and RS 0.8 (27, 28) are indicated by filled boxes.

One approach to estimate the extent of receptor editing in normal B cells is to analyze V(D)J recombinational remnants that are the predicted residue of editing. In mouse B cells, which contain both kappa  and lambda  L chain loci, lambda  gene rearrangement almost always occurs after kappa  rearrangement (for review see references 29, 30). Thus, if an appropriate kappa  gene is not assembled, rearrangement at the lambda  locus often follows. In lambda + B cells, RS rearrangements usually have deleted the Ckappa loci (27, 28, 31) either by recombining to Vkappa s, through the well characterized heptamer-nonamer recombination signal sequences (Fig. 1 B), or to heptamer sites in the Jkappa -Ckappa intron (Fig. 1 C) (27, 28, 32). Besides destroying the function of the kappa  locus, this latter mode of RS recombination has two important effects: first, unlike nested Vkappa Jkappa recombinations, it eliminates the Ckappa -associated cis-acting enhancer elements that are critical for Vkappa Jkappa expression and rearrangement (33), and second, it retains any Vkappa Jkappa join that was previously adjacent to Ckappa . This physiological knockout of regulatory sequences required for kappa  gene rearrangement thus "freezes" the locus, allowing an analysis of the Vkappa Jkappa gene that was assembled adjacent to the Ckappa exon just before RS and lambda  gene rearrangement.

In this study, we have isolated such Vkappa Jkappa joins from a large number of individual IgM+lambda + B cells and determined their nucleotide sequences in order to ascertain the extent to which RS inactivates functional kappa  genes in a normal, non-Ig Tg immune system. The results indicate that in normal IgM+ B cells RS-mediated receptor editing is induced by and frequently inactivates functionally rearranged kappa  genes, probably because of immune tolerance.

    Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mice.

Mice homozygous for the targeted deletion of the Jkappa - Ckappa locus (JCkappa D/JCkappa D; a gift from D. Huszar, GenPharm International, San Jose, CA; reference 33) were maintained under specific pathogen-free conditions in the animal care facility at National Jewish Medical and Research Center. JCkappa D/JCkappa D mice were bred with B10.D2nSn/J mice to generate B10.D2nSn/ J-JCkappa D/+ mice (JCkappa D/+), which were used at 6-8 wk of age.

Cell Sorting and Genomic DNA Isolation.

Splenic cells from JCkappa D/+ mice were isolated and stained with goat anti-mouse IgM-PE (Caltag Labs., San Francisco, CA) and goat anti-mouse lambda -FITC (Fisher Scientific Co., Pittsburgh, PA) and sorted on an ELITE flow cytometer (Coulter Corp., Miami, FL) to collect IgM+lambda + B cells. Genomic DNA was isolated from cells by overnight proteinase K digestion in lysis buffer (100 mM NaCl, 10 mM Tris-Cl, pH 8, 25 mM EDTA, 0.5% SDS) at 55°C, followed by phenol/chloroform extraction and EtOH precipitation.

Analysis of Direct PCR Amplified Ig Rearrangements.

Genomic DNA from sorted cells was used as a template to amplify Vkappa Jkappa -intron-RS rearrangements. As shown in Fig. 1, primers A (degenerate Vkappa framework region [FWR]3; reference 37) and B (RS -101, 5' ACATGGAAGTTTTCCCGGGAGAATATG 3') amplified a product of ~1,450 bps (for Jkappa 5) using an amplification profile of 1 min at 94°C, 1 min at 58°C and 1 min at 72°C for 30-35 cycles. The resulting Vkappa Jkappa 5-intron-RS products were gel isolated and cloned into the TA II vector (Invitrogen, Carlsbad, CA) and colonies were screened by hybridization using the IVS probe (1). PCR clones were sequenced by the dideoxy termination method (Sequenase; United States Biochemical Corp., Cleveland, OH) using vector-specific forward and reverse primers, as well as antisense Jkappa 5-specific (5' CTAACATGAAAACCTGTGTCTTACACA 3') and RS-specific (5' AAAGCTACATTAGGGCTCAAATCTGA 3') primers. Both DNA strands from the PCR clones were sequenced over the Vkappa Jkappa joins to verify the reading frame.

Production of lambda + Hybridomas.

Splenocytes from B10.D2nSn/J-JCkappa D/+ mice were cultured in DMEM supplemented with 10% fetal bovine sera plus 50 µg/ml LPS (E. coli LPS; Sigma Chemical Co., St. Louis, MO) for 3 d, then fused with NSO-bcl2 (38) myeloma cells for fusion 1 or SP2/0 (39) myeloma cells for fusions 2 through 5. Hybridoma supernatants were screened by ELISA for secretion of micrometer/liter Ig and the lack of kappa  Ig secretion.

Analysis of Hybridoma Ig Rearrangements.

Hybridoma genomic DNA was digested with EcoRI or BamHI, then fractionated on 0.8% agarose gels, blotted to nylon membrane, and hybridized with the RS 0.8 (27) or IVS probes (Fig. 1 A). Vkappa -RS rearrangements were identified by genomic Southern blot analysis using the RS probe and/or by PCR amplification using primer A and primer B to yield a PCR product of ~255 bps. Vkappa Jkappa -intron-RS rearrangements were identified by genomic Southern blot analysis using both the RS and IVS probes and/or by PCR amplification using primer C (Jkappa intron, 5' CTGACTGCAGGTAGCGTGGTCTTCTAG 3') and primer B, and amplified for isolation and sequencing using primers A and B. The resulting products were isolated from 1.8% low-melt agarose gels, cycle sequenced directly (Dye Terminator Cycle Sequencing Ready Reaction kit; PE Applied Biosystems, Norwalk, CT) and analyzed using an ABI 377 DNA Sequencer (PE Applied Biosystems). To obtain near full-length sequences of hybridoma 1-2A7, 1-2E11, 2-2H11, 3-15D6, 3-15C4 and 3-17B10 Vkappa genes, a consensus FWR1 oligo (amino acids -1 through 8; 5' GGTGACATTGTGCTGACCCAGTCTCCA 3') was used with antisense Jkappa -intron oligos for PCR amplification, followed by cycle sequencing of the products. For hybrids 1-3E8, 2-15E11, 3-7G5, 4-1D2, 1-10A11 and 1-11A4, Vkappa leader specific oligos (Ig Prime kit; Novagen, Madison, WI) were used for amplification.

Cloning and Expression of V(D)J Rearrangements for Analysis of H/kappa L Chain Pairing.

The H chain V(D)J and the L chain Vkappa Jkappa -RS rearrangements from hybridoma 2H11 were genomically cloned as previously described (40), with the modifications that lambda Zap (Stratagene, La Jolla, CA) was the cloning vector and the RS and IVS probes were used to screen clones for the Vkappa Jkappa -RS rearrangement. The 6.5-kb EcoRI fragment containing the V(D)J rearrangement and the 4.0-kb EcoRI-XbaI fragment containing the Vkappa Jkappa rearrangement were gel isolated and ligated to pRµSal, a Cµ expression vector (41) and pSV2-neo-Ckappa , a Ckappa expression vector (42) respectively. The H chain from hybridoma 15E11 was cloned by PCR amplification using a leader intron oligo (5' GAACTGGCAGGACCTGAGGTGAAAATGACA 3') and an oligo that spanned the XbaI site downstream of JH4 (5' CAGGCTCCACCAGACCTCTCTAGA 3'). The resulting product was digested with EcoO109I and XbaI and ligated into EcoO109I and XbaI digested 8-1Cµ (40), a Cµ expression vector. The Vkappa Jkappa -RS rearrangement from hybridoma 15E11 was also cloned by PCR using a leader intron oligo (5' TGGAATTCCAGGTTCTACTGGAGACATTGT-3') and an oligo which spanned the XbaI site downstream of Jkappa 5 (5' ACGAATTCGTCTAGAAGACCACGCTACCT 3'). The resulting product was digested with EcoRI and subcloned into a shuttle vector containing Vkappa 21C leader and promoter elements. An XbaI fragment that contained the promoter elements, leader, and the 15E11 Vkappa Jkappa rearrangement was isolated and cloned into the XbaI site in pSV2-neo-Ckappa (42). The 2H11 and 15E11 H and L chain constructs were then cotransfected into SP2/0 myeloma cells and selected for expression of IgMkappa as previously described (40).

IgMkappa ELISA for Analysis of H/kappa L Pairing.

Supernatants from 2H11 and 15E11 H and L chain transfectoma clones were assayed for IgMkappa expression by ELISA. In brief, goat anti-mouse IgM (Southern Biotechnology Associates, Inc., Birmingham, AL) was diluted in PBS, coated onto 96-well Immulon 2HB plates (Dynex Technologies, Inc., Chantilly, VA) and incubated at room temperature for 3 h. Plates were washed five times with PBS/Tween 20, then incubated with blocking buffer (PBS, 0.5% BSA, 0.4% Tween 20) for 1 h at room temperature. Serial dilution of transfectoma and parental hybridoma supernatants were added and incubated at room temperature for 2 h. Plates were washed and horseradish peroxidase-conjugated goat anti-mouse kappa  (Southern Biotechnology Associates, Inc.) was added and incubated for 2 h. After a final wash, the chromogenic substrate 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (Sigma Chemical Co.) was added in McIlvain's buffer (84 mM Na2PO4/48 mM citrate, pH 4.6) with 0.005% H2O2 and OD 410 nm was read using an automated plate reader (Dynatech, Alexandria, VA). Transfectoma and hybridoma antibody concentrations were estimated by comparison to a TEPC 183 (µkappa ) standard curve.

    Results
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Strategy for the Isolation of Editing Remnants.

To determine the extent to which RS recombination inactivates functional, in-frame Vkappa Jkappa joins in the preimmune B cell repertoire, IgM+lambda + splenic B cells were isolated by fluorescence activated cell sorting and their genomic DNA was analyzed by the PCR strategy outlined in Fig. 1 C. This cell sorting strategy should exclude from the template pool cells that are kappa +, H chain isotype switched, surface (s)Ig-, or cells of a sIglo, germinal center phenotype. In a second series of experiments, IgMlambda secreting hybridomas were isolated and their kappa  loci analyzed in detail. To simplify these analyses, all B cells analyzed were heterozygous for a targeted deletion of the Jkappa -Ckappa locus (JCkappa D/+), in which only a single kappa  locus and RS allele could rearrange (33). The potential kappa  gene and RS element rearrangements are depicted in Fig. 1.

Analysis of IgMlambda Cells Reveals Frequent Receptor Editing.

Genomic DNA from sorted IgMlambda cells was used as template for a PCR using a panspecific Vkappa FWR 3 oligonucleotide primer, which recognizes ~80% of Vkappa genes (37), together with an RS-specific primer to amplify Vkappa Jkappa -intron-RS rearrangements (Fig. 1 C, primers A and B). Vkappa Jkappa -intron-RS rearrangements containing Vkappa genes rearranged to each of the four functional Jkappa genes were detected by PCR amplification and Southern blotting (data not shown), but Vkappa Jkappa 5-intron-RS rearrangements were most abundant, in part because their smaller size promoted preferential amplification. Amplified Vkappa Jkappa 5-intron-RS rearrangements were gel-purified and cloned, and a total of 52 clones were sequenced across both the Vkappa Jkappa and the Jkappa -intron-RS joins (Fig. 2). These two different recombination joins, present on each PCR product analyzed, provided markers for uniqueness. PCR products that were identical to one another, or that differed by just one nucleotide, were assumed to represent repeated isolates derived from the same initial template (i.e., derived from a single B cell clone). This represents an underestimate because the single base changes could have reflected real differences and because it was possible that some of the apparent repeats were independent events that happened to have identity in the portions of the genes studied, but not in upstream portions of the V genes. In this sample, at least 37 of the 52 clones represented independent events. Analysis of the Vkappa Jkappa join sequences allowed an assessment of the potential prior functionality of the Vkappa Jkappa 5 joins just upstream of intron-RS rearrangements. Surprisingly, 15 of the 37 clones (41%) contained Vkappa Jkappa joins that were in-frame (Fig. 2), and if the apparent repeats were not excluded 23 out of 52 (44%) were in-frame.


View larger version (57K):
[in this window]
[in a new window]
  		Fig. 2.   Sequence analysis of (A) productive and (B) nonproductive Vkappa Jkappa -intron-RS rearrangements from FACS® sorted, IgM+lambda + splenic B cells. Vkappa gene family and Jkappa gene usage were assigned based on homologies to expressed Vkappa Jkappa genes (52) or homology searches of Genbank and the Kabat Ig database. Translated Vkappa FWR3 (codons 70-88), CDR3, and Jkappa 5 sequences to the conserved phenylalanine (F) are shown for productive rearrangements, whereas FWR3 and CDR3 sequences are shown for nonproductive rearrangements, with the asterisk (*) adjacent to CDR3 in B denoting an out of frame Vkappa Jkappa join. The nucleotide sequences of the unrearranged Jkappa intronic recombining sequence 1 (IRS1) and RS element (both of which contain a consensus heptamer sequence adjacent to the Delta  symbol) are shown above the sequences of the IRS1-RS joins present in each PCR clone. The RS join sequence for clone 17 was not determined. Underlined nucleotides could have been donated by either the IRS1 or the RS sequence, and N region addition (bold) and P-encoded nucleotides are shown between the joins. Repeats denote the number of times a particular sequence was observed.

To verify the analysis of the PCR-amplified Vkappa Jkappa -intron-RS rearrangements and to increase the sample size, an independent sampling of Vkappa Jkappa -intron-RS rearrangements was derived from JCkappa D/+ splenocytes in the form of B cell hybridomas. A total of 133 IgMlambda -expressing hybrids were obtained from five separate fusions and their kappa  locus rearrangements were analyzed. Genomic Southern blot and PCR analysis revealed that at least 74% of the lambda + hybrids (99 out of 133) had inactivated the wild-type kappa  locus by RS rearrangements (Table 1), a value in accord with previous estimates (31, 34). Two hybridomas apparently had undergone inversional Vkappa -RS rearrangements, as they had unique restriction fragments that retained the Ckappa locus as revealed by the intron (IVS) probe (data not shown), but scored positive in a Vkappa -RS PCR (Fig. 1 B). Approximately 25% (26 out of 99) of the hybridomas with RS rearrangements had Jkappa -intron-RS joins (Table 1), as detected with primers B and C (Fig. 1 C). Genomic Southern blot analysis of 18 out of 20 hybrids scoring PCR positive for Jkappa - intron-RS rearrangements demonstrated that the RS rearrangements colocalized with EcoRI restriction fragments hybridizing with the IVS probe (data not shown), thus independently confirming the Vkappa Jkappa -intron-RS rearrangement phenotype. Vkappa Jkappa -intron-RS rearrangements from individual hybridomas were PCR amplified and directly sequenced, rather than cloned, a procedure that diminishes potential Taq polymerase-generated mutations. Like the Vkappa Jkappa -intron-RS PCR clones, most of the Vkappa Jkappa -intron-RS loci from hybridomas used Jkappa 5, although four hybridomas had rearrangements to upstream Jkappa s, including one to Jkappa 2 and three to Jkappa 4, suggesting that developing B cells do not frequently undergo RS rearrangement until all of the Jkappa s are rearranged. Sequence analysis over both the Vkappa Jkappa and intron-RS joins clearly showed that each cell line had a unique sequence at the Vkappa Jkappa join and that, remarkably, 12 of 20 (60%) of the Vkappa Jkappa joins were in-frame (Fig. 3 A).

                              
View this table:
[in this window]
[in a new window]
 

Table 1
kappa Locus Rearrangement Status of IgMlambda Hybridomas


View larger version (55K):
[in this window]
[in a new window]
  		Fig. 3.   Sequence analysis of Vkappa Jkappa - intron-RS rearrangements from IgMlambda hybridomas. (A) Sequences of the Vkappa Jkappa rearrangements. The first digit in the hybridoma name indicates the fusion experiment number. Myeloma fusion partners were either NSO-bcl2 (fusion 1) or SP2/0 (fusions 2-5). Vkappa gene family and Jkappa gene usage were assigned as described in Fig. 2. P and NP denote productive and nonproductive Vkappa Jkappa rearrangements, respectively. Translated amino acid sequences of Vkappa FWR, CDR, and Jkappa sequences to the conserved phenylalanine (F) residue are shown for productive rearrangements, and Vkappa FWR and CDR sequences, with * denoting an out of frame Vkappa Jkappa join and # denoting an in-frame stop codon, are shown for nonproductive rearrangements. These sequence data are available from EMBL/Genbank/DDBJ under accession numbers AF087023-AF087034 and AF087460-AF087467. (B) Sequences of the RS rearrangements (as described in Fig. 2).

Diversity of V Gene Usage.

Vkappa Jkappa -intron-RS rearrangements were clearly diverse because at least 32 different Vkappa genes representing 11 of the 19 Vkappa families were identified among the 57 independent Vkappa Jkappa -intron-RS loci analyzed (data not shown). This value of Vkappa gene representation in the Vkappa Jkappa -intron-RS loci analyzed is most likely an underestimate of the diversity because the 5' PCR primer lies in FWR3 and yields only a short stretch of Vkappa gene sequence for interclonal comparison. Despite this limitation, multiple genes were observed within particular Vkappa gene families. For example, within the Vkappa 4/5 family, at least 11 different genes were represented among the 14 in-frame and 7 out-of-frame joins (data not shown). In addition, Vkappa genes were sometimes found repeatedly in independent Vkappa Jkappa -intron-RS rearrangements and there was considerable overlap in usage among hybridoma and PCR clone sequences. 13 of the hybridomas used Vkappa genes that were observed in the direct PCR-derived clones, whereas 6 hybridomas expressed distinct Vkappa genes that were members of families observed in the PCR clone sample and 1 hybridoma expressed a Vkappa 32 gene, a Vkappa family not seen in the PCR clone samples (Figs. 2 and 3 and data not shown).

Intron/RS Joins.

The sequences of the Jkappa -intron-RS joins in both the PCR clones (Fig. 2) and hybridomas (Fig. 3 B) were quite varied and were dominated by deletions at both sides of the joins, as up to nine nucleotides were missing from either the Jkappa -intron or RS heptamer-flanking sequences. There did appear to be a bias for a particular join (e.g., clone 4, Fig. 2 A), which was observed to be associated with 13 independent Vkappa Jkappa rearrangements. Two of the intron-RS joins contained P nucleotides and one contained N-region addition nucleotides, consistent with findings described previously (7, 43).

Rebuilding IgMkappa Antibodies for Analysis of H/kappa L Pairing and Antigen Specificity.

To determine if the high frequency of in-frame Vkappa Jkappa rearrangements silenced by intron-RS recombination was due to the inability of H chains to pair with their kappa  L chains, the V(D)J and Vkappa Jkappa rearrangements from hybridomas 2H11 and 15E11 were cloned into Cµ and Ckappa expression vectors, respectively. These H and L chain constructs were cotransfected into SP2/0 myeloma cells to generate transfectoma clones. Analysis of transfectoma supernatants by IgMkappa sandwich ELISA revealed that the in-frame kappa L chains were able to pair with their hybridoma H chains (Fig. 4), suggesting that ongoing RS rearrangement was not due to the inability of H/L chain pairing. The specificity of the µkappa transfectoma antibodies remains unknown, however. Attempts in flow cytometry assays to detect recombinant antibody binding to the surfaces of bone marrow cells were unsuccessful (data not shown).


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 4.   "Repair" of intron-RS recombination-silenced Vkappa Jkappa genes by restoration of Ckappa exon and surrounding elements reveals that silenced kappa L chains can pair with their original µ chain partner. The graph shows representative results from a µkappa ELISA comparing several IgMkappa transfectoma antibodies (Tfc) to their IgMlambda parental hybridoma antibodies (Hyb). Antibodies in supernatants were captured on plastic using adsorbed anti-µ chain antibodies and revealed with anti-kappa conjugates. Bars indicate the SD determined from antibodies assayed in triplicate. The concentrations of the hybridoma antibodies were at least 10-fold higher than those of the transfectoma antibodies based on comparison to a TEPC 183 (µ, kappa ) standard curve.

    Discussion
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

In this report we examined the DNA sequences of Vkappa Jkappa joins located upstream of intronic-RS rearrangements in normal, non-Ig Tg B cells to determine the extent to which RS-mediated recombination silences functionally rearranged kappa  genes. Nearly half of all Vkappa Jkappa joins inactivated by RS recombination were in-frame (27 out of 57). This high frequency is clearly incompatible with a strict feedback suppression model of L chain allelic exclusion, which predicts no in-frame Vkappa Jkappa joins upstream of the RS rearrangements. More strikingly, this high frequency is also significantly higher than 33%, the percentage of in-frame joins expected from random Vkappa Jkappa rearrangement, indicating that productive Vkappa Jkappa rearrangements actively induce intron-RS rearrangements. The data also demonstrate a physiological role for the RS element in normal B cell development---the inactivation of functionally rearranged kappa  genes.

To understand why we conclude that the RS rearrangements were actively induced by functional kappa  L chains, consider the extreme hypothetical cases of mice in which all kappa  gene rearrangements result in either autoreactive B cell receptors or nonproductive kappa  chains (Table 2). If Vkappa -to-Jkappa and RS rearrangements proceed randomly, albeit with different relative frequencies, then in either case Vkappa Jkappa joins located upstream of intronic-RS rearrangements should be in-frame at a maximum frequency of one out of three. To significantly exceed this frequency, in-frame Vkappa Jkappa joins must stimulate the relative rate of (intronic) RS rearrangement. This argument applies to our data because the observed frequency of in-frame joins, 47.4%, is significantly higher than one out of three (P < 0.04, single sample test of a proportion based on a normal approximation). Since it is exceedingly unlikely that the stimulus for increased in-frame rearrangements is mediated by anything other than kappa  protein, and because kappa  chains can probably only be perceived by the signaling machinery of B cells through their association with H chains, we conclude that functional kappa chains actively stimulate the rate of RS rearrangement based on B cell receptor antigenic specificity. These data also predict that in mice in which the Ckappa exon is inactivated, but surrounding cis-acting elements are left intact, Vkappa Jkappa rearrangement should be extensive, whereas RS rearrangement should be reduced. This is in fact the experimental observation (44).

                              
View this table:
[in this window]
[in a new window]
 

Table 2
Analysis of Vkappa Jkappa Joins in Vkappa Jkappa -intron-RS Sequences: Models and Predictions Compared with Experimental Data

The statistical argument also excludes the possibility that a high frequency of rearrangeable Vkappa pseudogenes, L chains that fail to pair with H chains, or a role for positive selection is responsible for our results. Furthermore, complete sequencing of the coding regions from all the in-frame Vkappa Jkappa rearrangements derived from lambda + hybridomas revealed no stop codons or other obvious defects that would have precluded function (Fig. 3 A). It is also unlikely that frequent aberrant H/L chain pairing is responsible for the high frequency of in-frame Vkappa Jkappa joins in the Vkappa Jkappa -intron-RS rearrangements, as demonstrated by the ability of H/kappa L chains from two hybridomas to pair (Fig. 4). Moreover, there are few examples of L chains that fail to pair with H chains and most experiments suggest that virtually all random H/L pairs can associate (40, 45). Finally, if a lack of positive selection of surface Ig was responsible for the high frequency of in-frame joins, this would predict that B cells should frequently express two kappa  chains, a result that has not been observed.

The receptor editing events documented in this study probably do not represent renewed V(D)J recombination in mature B cells, such as has recently been described in the germinal center (49), because the cells analyzed expressed high levels of IgM and lambda chain and because they were isolated and, in the case of the hybridomas, stimulated in a manner that should not have induced V(D)J recombination. Another indication that receptor editing in mature B cells is unlikely to explain our results is that the fraction of lambda + cells in newly formed and mature splenic B cells is nearly identical, suggesting that in unmanipulated mice mature kappa + cells rarely give rise to lambda + B cells (44). Overall, it would appear from our data that the RS rearrangements that we studied were actually stimulated, rather than inhibited, by productive kappa  gene rearrangements, probably as the result of immune tolerance-mediated receptor editing in immature B cells. To definitively test the prediction that the kappa  chains of the cells that we have analyzed generate autoantibodies in association with the same cell's heavy chain, it will be necessary to generate mice transgenic for these genes.

    Footnotes

Address correspondence to David Nemazee, The Scripps Research Institute, Mail drop IMM-29, 10550 North Torrey Pines Rd., La Jolla, CA 92037. Phone: 619-784-9528; Fax: 619-784-8805; E-mail: nemazee{at}scripps.edu

Received for publication 20 February 1998 and in revised form 22 July 1998.

We thank D. Huszar for providing JCkappa D/JCkappa D mice; B. Diamond (Albert Einstein College of Medicine, Bronx, NY) for providing the NSO-bcl2 myeloma; S. Sobus for cell sorting; D. Norsworthy for cycle sequence analyses; D. Iklé of the Biostatistics Department for statistical analyses; K. Karjalainen and L. Wysocki for discussions; and M. Hertz, D. Melamed, V. Kouskoff, and other members of the lab for critical reading of the manuscript.

This work was supported by grants from the National Institutes of Health and the Arthritis Foundation.

Abbreviations used in this paper FWR, framework region; JCkappa D/+, heterozygous kappa  deficient germline genotype; RS, recombining sequence; Tg, transgenic.

    References
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Coleclough, C., R.P. Perry, K. Karjalainen, and M. Weigert. 1981. Aberrant rearrangements contribute significantly to the allelic exclusion of immunoglobulin gene expression. Nature. 290: 372-378 [Medline].
2. Nussenzweig, M.C., A.C. Shaw, E. Sinn, D.B. Danner, K.L. Holmes, H.C. Morse III, and P. Leder. 1987. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin µ. Science. 236: 816-819 [Abstract/Free Full Text].
3. Manz, J., K. Denis, O. Witte, R. Brinster, and U. Storb. 1988. Feedback inhibition of immunoglobulin gene rearrangement by membrane µ but not by secreted µ heavy chains. J. Exp. Med. 168: 1363-1381 [Abstract/Free Full Text].
4. Ritchie, K.A., R.L. Brinster, and U. Storb. 1984. Allelic exclusion and control of endogenous immunoglobulin gene rearrangement in kappa  transgenic mice. Nature. 312: 517-520 [Medline].
5. Storb, U. 1995. Ig gene expression and regulation in Ig transgenic mice. In Immunoglobulin Genes. Second Edition. T. Honjo and F.W. Alt, editors. Academic Press, San Diego, CA. 345-363.
6. Gollahon, K.A., J. Hagman, R.L. Brinster, and U. Storb. 1988. Ig lambda -producing B cells do not show feedback inhibition of gene rearrangement. J. Immunol. 141: 2771-2780 [Abstract].
7. Harada, K., and H. Yamagishi. 1991. Lack of feedback inhibition of Vkappa gene rearrangement by productively rearranged alleles. J. Exp. Med. 173: 409-415 [Abstract/Free Full Text].
8. Doglio, L., J.Y. Kim, G. Bozek, and U. Storb. 1994. Expression of lambda  and kappa  genes can occur in all B cells and is initiated around the same pre-B-cell developmental stage. Dev. Immunol. 4: 13-26 [Medline].
9. Ghia, P., A. Gratwohl, E. Signer, T.H. Winkler, F. Melchers, and A.G. Rolink. 1995. Immature B cells from human and mouse bone marrow can change their surface light chain expression. Eur. J. Immunol. 25: 3108-3114 [Medline].
10. Gay, D., T. Saunders, S. Camper, and M. Weigert. 1993. Receptor editing: an approach by autoreactive B cells to escape tolerance. J. Exp. Med. 177: 999-1008 [Abstract/Free Full Text].
11. Radic, M.Z., J. Erikson, S. Litwin, and M. Weigert. 1993. B lymphocytes may escape tolerance by revising their antigen receptors. J. Exp. Med. 177: 1165-1173 [Abstract/Free Full Text].
12. Tiegs, S.L., D.M. Russell, and D. Nemazee. 1993. Receptor editing in self-reactive bone marrow B cells. J. Exp. Med. 177: 1009-1020 [Abstract/Free Full Text].
13. Chen, C., M.Z. Radic, J. Erikson, S.A. Camper, S. Litwin, R.R. Hardy, and M. Weigert. 1994. Deletion and editing of B cells that express antibodies to DNA. J. Immunol. 152: 1970-1982 [Abstract].
14. Prak, E.L., M. Trounstine, D. Huszar, and M. Weigert. 1994. Light chain editing in kappa -deficient animals: a potential mechanism of B cell tolerance. J. Exp. Med. 180: 1805-1815 [Abstract/Free Full Text].
15. Lang, J., M. Jackson, L. Teyton, A. Brunmark, K. Kane, and D. Nemazee. 1996. B cells are exquisitely sensitive to central tolerance and receptor editing induced by ultralow affinity, membrane-bound antigen. J. Exp. Med. 184: 1685-1697 [Abstract/Free Full Text].
16. Hertz, M., and D. Nemazee. 1997. BCR ligation induces receptor editing in IgM+IgD- bone marrow B cells in vitro. Immunity. 6: 429-436 [Medline].
17. Melamed, D., and D. Nemazee. 1997. Self-antigen does not accelerate immature B cell apoptosis, but stimulates receptor editing as a consequence of developmental arrest. Proc. Natl. Acad. Sci. USA. 94: 9267-9272 [Abstract/Free Full Text].
18. Melamed, D., R.J. Benschop, J.C. Cambier, and D. Nemazee. 1998. Developmental regulation of B lymphocyte immune tolerance compartmentalizes clonal selection from receptor editing. Cell. 92: 173-182 [Medline].
19. Chen, C., E.L. Prak, and M. Weigert. 1997. Editing disease-associated autoantibodies. Immunity. 6: 97-105 [Medline].
20. Pelanda, R., S. Schwers, E. Sonoda, R.M. Torres, D. Nemazee, and K. Rajewsky. 1997. Receptor editing in a transgenic mouse model: site, efficiency, and role in B cell tolerance and antibody diversification. Immunity. 7: 765-775 [Medline].
21. Nemazee, D. 1995. B lymphocyte tolerance in the mouse. In Immunoglobulin Genes. Second Edition. T. Honjo and F.W. Alt, editors. Academic Press, Inc., San Diego, CA. 365-378.
22. Feddersen, R.M., and B.G. Van Ness. 1990. Corrective recombination of mouse immunoglobulin kappa alleles in Abelson murine leukemia virus-transformed pre-B cells. Mol. Cell. Biol. 10: 569-576 [Abstract/Free Full Text].
23. Hertz, M., and D. Nemazee. 1998. Receptor editing and commitment in B lymphocytes. Curr. Opin. Immunol. 10: 208-213 [Medline].
24. Siminovitch, K.A., A. Bakhshi, P. Goldman, and S.J. Korsmeyer. 1985. A uniform deleting element mediates the loss of kappa  genes in human B cells. Nature. 316: 260-262 [Medline].
25. Muller, B., H. Stappert, and M. Reth. 1990. A physical map and analysis of the murine Ckappa -RS region show the presence of a conserved element. Eur. J. Immunol. 20: 1409-1411 [Medline].
26. Daitch, L.E., M.W. Moore, D.M. Persiani, J.M. Durdik, and E. Selsing. 1992. Transcription and recombination of the murine RS element. J. Immunol. 149: 832-840 [Abstract].
27. Durdik, J., M.W. Moore, and E. Selsing. 1984. Novel kappa  light-chain gene rearrangements in mouse lambda  light chain-producing B lymphocytes. Nature. 307: 749-752 [Medline].
28. Moore, M.W., J. Durdik, D.M. Persiani, and E. Selsing. 1985. Deletions of kappa  chain constant region genes in mouse lambda  chain-producing B cells involve intrachromosomal DNA recombinations similar to V-J joining. Proc. Natl. Acad. Sci. USA. 82: 6211-6215 [Abstract/Free Full Text].
29. Selsing, E., and L.E. Daitch. 1995. Immunoglobulin lambda  genes. In Immunoglobulin Genes. Second Edition. T. Honjo and F.W. Alt, editors. Academic Press, San Diego, CA. 193-203.
30. Arakawa, H., T. Shimizu, and S. Takeda. 1996. Re-evaluation of the probabilities for productive arrangements on the kappa  and lambda  loci. Int. Immunol. 8: 91-99 [Abstract/Free Full Text].
31. Nadel, B., P.A. Cazenave, and P. Sanchez. 1990. Murine lambda gene rearrangements: the stochastic model prevails over the ordered model. EMBO (Eur. Mol. Biol. Org.) J. 9: 435-440 [Medline].
32. Shimizu, T., T. Iwasato, and H. Yamagishi. 1991. Deletions of immunoglobulin Ckappa region characterized by the circular excision products in mouse splenocytes. J. Exp. Med. 173: 1065-1072 [Abstract/Free Full Text].
33. Chen, J., M. Trounstine, C. Kurahara, F. Young, C.C. Kuo, Y. Xu, J.F. Loring, F.W. Alt, and D. Huszar. 1993. B cell development in mice that lack one or both immunoglobulin kappa  light chain genes. EMBO (Eur. Mol. Biol. Organ.) J. 12: 821-830 [Medline].
34. Takeda, S., Y.R. Zou, H. Bluethmann, D. Kitamura, U. Muller, and K. Rajewsky. 1993. Deletion of the immunoglobulin kappa  chain intron enhancer abolishes kappa  chain gene rearrangement in cis but not lambda  chain gene rearrangement in trans. EMBO (Eur. Mol. Biol. Organ.) J. 12: 2329-2336 [Medline].
35. Xu, Y., L. Davidson, F.W. Alt, and D. Baltimore. 1996. Deletion of the Ig kappa  light chain intronic enhancer/matrix attachment region impairs but does not abolish Vkappa Jkappa rearrangement. Immunity. 4: 377-385 [Medline].
36. Gorman, J.R., N. van der Stoep, R. Monroe, M. Cogne, L. Davidson, and F.W. Alt. 1996. The Igkappa 3' enhancer influences the ratio of Igkappa versus Iglambda B lymphocytes. Immunity. 5: 241-252 [Medline].
37. Schlissel, M.S., and D. Baltimore. 1989. Activation of immunoglobulin kappa gene rearrangement correlates with induction of germline kappa gene transcription. Cell. 58: 1001-1007 [Medline].
38. Ray, S., and B. Diamond. 1994. Generation of a fusion partner to sample the repertoire of splenic B cells destined for apoptosis. Proc. Natl. Acad. Sci. USA. 91: 5548-5551 [Abstract/Free Full Text].
39. Kearney, J.F., A. Radbruch, B. Liesegang, and K. Rajewsky. 1979. A new mouse myeloma cell line that has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell lines. J. Immunol. 123: 1548-1550 [Abstract/Free Full Text].
40. Retter, M.W., R.A. Eisenberg, P.L. Cohen, and S.H. Clarke. 1995. Sm and DNA binding by dual reactive B cells requires distinct VH, Vkappa , and VH CDR3 structures. J. Immunol. 155: 2248-2257 [Abstract].
41. Nemazee, D.A., and K. Burki. 1989. Clonal deletion of B lymphocytes in a transgenic mouse bearing anti-MHC class I antibody genes. Nature. 337: 562-566 [Medline].
42. Retter, M.W., P.L. Cohen, R.A. Eisenberg, and S.H. Clarke. 1996. Both Sm and DNA are selecting antigens in the anti-Sm B cell response in autoimmune MRL/lpr mice. J. Immunol. 156: 1296-1306 [Abstract].
43. Graninger, W.B., P.L. Goldman, C.C. Morton, S.J. O'Brien, and S.J. Korsmeyer. 1988. The kappa -deleting element. Germline and rearranged, duplicated and dispersed forms. J. Exp. Med. 167: 488-501 [Abstract/Free Full Text].
44. Zou, Y.R., S. Takeda, and K. Rajewsky. 1993. Gene targeting in the Igkappa locus: efficient generation of lambda  chain-expressing B cells, independent of gene rearrangements in Igkappa . EMBO (Eur. Mol. Biol. Organ.) J. 12: 811-820 [Medline].
45. Hamel, P.A., M.H. Klein, S.J. Smith-Gill, and K.J. Dorrington. 1987. Relative noncovalent association constant between immunoglobulin H and L chains is unrelated to their expression or antigen-binding activity. J. Immunol. 139: 3012-3020 [Abstract].
46. Kaushik, A., D.H. Schulze, F.A. Bonilla, C. Bona, and G. Kelsoe. 1990. Stochastic pairing of heavy-chain and kappa  light-chain variable gene families occurs in polyclonally activated B cells. Proc. Natl. Acad. Sci. USA. 87: 4932-4936 [Abstract/Free Full Text].
47. De Lau, W.B., K. Heije, J.J. Neefjes, M. Oosterwegel, E. Rozemuller, and B.J. Bast. 1991. Absence of preferential homologous H/L chain association in hybrid hybridomas. J. Immunol. 146: 906-914 [Abstract].
48. Radic, M.Z., M.A. Mascelli, J. Erikson, H. Shan, and M. Weigert. 1991. Ig H and L chain contributions to autoimmune specificities. J. Immunol. 146: 176-182 [Abstract].
49. Papavasiliou, F., R. Casellas, H. Suh, X.F. Qin, E. Besmer, R. Pelanda, D. Nemazee, K. Rajewsky, and M.C. Nussenzweig. 1997. V(D)J recombination in mature B cells: a mechanism for altering antibody responses. Science. 278: 298-301 [Abstract/Free Full Text].
50. Han, S., S.R. Dillon, B. Zheng, M. Shimoda, M.S. Schlissel, and G. Kelsoe. 1997. V(D)J recombinase activity in a subset of germinal center B lymphocytes. Science. 278: 301-305 [Abstract/Free Full Text].
51. Hikida, M., and H. Ohmori. 1998. Rearrangement of lambda -light chain genes in mature B cells in vitro and in vivo. Function of reexpressed RAG gene products. J. Exp. Med. 187: 795-799 [Abstract/Free Full Text].
52. Strohal, R., A. Helmberg, G. Kroemer, and R. Kofler. 1989. Mouse Vkappa gene classification by nucleic acid sequence similarity. Immunogenetics. 30: 475-493 [Medline].
Copyright © 1998 by The Rockefeller University Press.
0022-1007/98/10/1231/08 $2.00
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles: