|
||
Chain
By


From the * Department of Genetics, The T cell repertoire is shaped by positive and negative selection of thymocytes through the
interaction of Although the diversity of Although it is widely accepted that self-peptides play a
central role in negative selection, the role of self-peptides in positive selection has been the subject of considerable debate (13, 14). This issue was first directly addressed for positive selection of CD8+ T cells using fetal thymic organ
cultures derived from mutant mouse strains where a particular MHC class I-peptide complex is expressed by exogenously adding a given peptide to the culture (15). More
recently, several groups developed in vivo experimental systems focusing on the role of self-peptides in positive selection of CD4+ T cells, by creating mouse strains that express MHC class II molecules predominantly occupied
with a single peptide (20). The conclusions deduced
from these in vitro and in vivo studies for positive selection
of CD8+ or CD4+ T cells are largely in agreement:
whereas limited numbers of self-peptides bound to a given
MHC molecule promoted the positive selection of T cells
expressing diverse sets of TCR- To clarify specific TCR-peptide contacts in positive selection, we analyzed the structure of TCR- Mice.
Core
Research for Evolutional Science and Technology (CREST), Japan Science and Technology
Corporation, Fukuoka 812-8582, Japan
![]()
Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
/
-T cell receptors (TCR) with self-peptides bound to self-major histocompatibility complex (MHC) molecules. However, the involvement of specific TCR-peptide contacts in positive selection remains unclear. By fixing TCR-
chains with a single rearranged
TCR-
irrelevant to the selecting ligand, we show here that T cells selected to mature on a
single MHC-peptide complex express highly restricted TCR-
chains in terms of V
usage
and amino acid residue of their CDR3 loops, whereas such restriction was not observed with
those selected by the same MHC with diverse sets of self-peptides including this peptide. Thus,
we visualized the TCR structure required to survive positive selection directed by this single
ligand. Our findings provide definitive evidence that specific recognition of self-peptides by
TCR could be involved in positive selection of thymocytes.
chain;
T cell repertoire;
transgenic knockout mice
![]()
Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
/
-TCR theoretically reaches
1015 by random rearrangement of five gene segments
(V
, J
, V
, D
, and J
) and random nucleotide addition (1),
mature T cells express highly selected TCR in that they
exhibit tolerance to self-antigenic peptides and restriction by
self-MHC molecules. This mainly results from two reciprocal selection processes, positive and negative selection, acting
during T cell development in the thymus. Positive selection
is the process that induces differentiation of CD4+CD8+
immature thymocytes into CD4
CD8+ or CD4+CD8
mature thymocytes that mount immune response on foreign antigenic peptides bound to self-MHC molecules in
the periphery, only when their TCR recognize self-MHC
class I or class II molecules in the thymic environment (2-
7). On the other hand, negative selection is the process that
eliminates immature thymocytes bearing TCR specific for
self-peptides bound to self-MHC molecules (8).
/
with no obvious structural features, this complex could not be a positively selecting ligand for T cells expressing a particular transgenic TCR-
/
that is selected to mature on the same MHC
molecule with a normal array of self-peptides (25). This
might reflect the weak but specific recognition of selecting
peptides by TCR-
/
in positive selection. However, experiments using TCR-
/
transgenic mice could not exclude the possibility that side chains of the peptides interfere with the interaction of the analyzed TCR-
/
with
MHC molecule that would be essentially required for positive selection (29). In this respect, it would be important to
assess whether specific TCR-peptide contacts are involved
in positive selection, under physiological conditions where
developing thymocytes express diverse sets of TCR-
/
.
Sant'Angelo et al. (30) recently addressed this issue by analyzing a particular V
-J
segment in mice lacking H-2M
(H-2M0/0)1 that catalyzes the dissociation of invariant
chain-derived class II-associated peptide, CLIP, in the
presence of a single rearranged TCR-
chain. Although
this study has shown that alternation of self-peptide repertoire affects CDR3 length of the selected TCR-
repertoire, no remarkable bias for amino acid composition of
their CDR3 loops could be deduced. This might be a general feature of a positively selected T cell repertoire. Alternatively, this may be the result of the heterogeneity of selecting peptides, because it has been shown that peptides
other than CLIP are bound to I-Ab molecules and contribute to the positive selection of CD4+ thymocytes in
H-2M0/0 mice (26). In addition, it remains unclear from
this study whether self-peptides involved in positive selection would affect variable gene segments of the selected
TCR repertoire and this needs to be known if one is to
better understand TCR-MHC-peptide interaction in positive selection process.
chains expressed on CD4+CD8
thymocytes selected to mature on
a single ligand, I-Ab molecule covalently bound to E
-
derived peptide (E
52-68), in the presence of a single rearranged TCR-
chain with irrelevant specificity for this
ligand. Since positive selection is thought to be mediated
through low affinity interaction of TCR-
/
with MHC-
peptide ligands (31), introduction of the TCR-
chain irrelevant to I-Ab-E
52-68 complex would give us a better
chance to reveal structural features of the associated TCR-
chains selected by this ligand. Therefore, we have selected
the 2B4 TCR-
chain derived from the TCR-
/
specific
for moth cytochrome c peptide bound to I-Ek or I-Eb molecules (32). By comparing the TCR-
repertoire shaped
by I-Ab-E
52-68 complex with that by I-Ab molecules
with a normal array of self-peptides, including E
52-68, in
the presence 2B4 TCR-
chain, we demonstrate here that
expression of TCR-
chains with both particular V
segments and amino acid residue in their CDR3 loops is required to survive positive selection by this single ligand.
These findings provide definitive evidence that specific
TCR-peptide interaction could be involved in the positive
selection of thymocytes.
![]()
Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
b chain covalently
bound to E
52-68 but lack endogenous I-A
b and invariant
chains (B2L DKO) have been described (24). B2L DKO mice
were crossed with
2-microglobulin-deficient mice carrying H-2b haplotype (
20/0; Jackson Laboratories, Bar Harbor, ME),
and B2L mice lacking the endogenous I-A
b chain, invariant
chain, and
2-microglobulin were developed (B2L TKO). To
develop B2L TKO/2B4
mice, we crossed B2L TKO with mice transgenic for 2B4 TCR-
chain that were maintained of
C57BL/6 (B6) background (H-2b) in our facility (33).
20/0/
2B4
or E
-B6/2B4
mice were developed by crossing TKO/
2B4
mice with
20/0 or E
transgenic B6 (E
-B6) mice (34),
respectively.
Antibodies.
The following mAbs were purchased from PharMingen (San Diego, CA): FITC-anti-CD8 (53-6.7); PE- anti-CD4 (RM4-5); biotinylated anti-NK1.1 (PK136); purified anti-CD24 (HSA, J11D); FITC-anti-TCR V
2 (B20.1); V
3.2
(RR3-16); V
8 (B21.14); FITC-anti-TCR V
2 (B20.6); V
4
(KT4); V
5 (MR9-4); V
6 (RR4-7); V
7 (TR310); V
8
(MR5-2); V
9 (MR10-2); V
10 (B21.5); V
11 (RR3-15);
V
12 (MR11-1); V
13 (MR12-3); V
14 (14-2); and biotinylated anti-TCR V
3 (KJ25). The mouse IgM mAb specific for
CD8 used for the killing experiments were purchased from Meiji
Institute of Health Science (Tokyo, Japan).
Flow Cytometry and Cell Sorting.
Single cell suspensions of thymocytes were prepared from mice 6-7 wk old and stained with FITC-anti-CD8, PE-anti-CD4, and biotinylated anti-NK1.1 or biotinylated anti-TCR V
3 mAb followed by streptavidin-Cy-Chrome (PharMingen). To assess the expression of
TCR V
or V
on CD4+CD8
thymocytes, thymocytes were
incubated with anti-CD8 and anti-HSA IgM mAbs, followed
by rabbit complement to remove immature thymocytes and
CD4
CD8+ thymocytes. Viable cells recovered using Lympholyte-M (Cedarlane, Ontario, Canada) were stained with PE-
anti-CD4 and FITC-anti-TCR V
or V
mAb, with or without
biotinylated anti-TCR V
3 followed by streptavidin-Cy-Chrome.
Analyses were done on a FACScan® (Becton Dickinson, Mountain View, CA). For cell sorting, CD4+CD8
thymocytes were
enriched as described above and were stained with PE-anti-CD4
and FITC-anti-CD8, with or without biotinylated anti-TCR
V
3 mAb followed by streptavidin-Cy-Chrome. CD4+CD8
or
CD4+CD8
V
3hi thymocytes (1-2 × 105) were sorted out using
EPICS ELITE® (Coulter Corp., Hialeah, FL) or FACS® Vantage
(Becton Dickinson) and were immediately placed in liquid nitrogen. All reagents were used at 10 µg/ml.
Mixed Lymphocyte Reaction.
Lymph node CD4+ T cells were prepared by eliminating CD8+ T cells and B cells from lymph node cells using anti-CD8 antibody followed by immunomagnetic beads coated with anti-Rat IgG antibody and those coated with anti-mouse IgG antibody (both from DYNAL, Oslo, Norway). The lymph node CD4+ T cells (1 × 105 cells/well) were cultured with irradiated spleen cells (1 × 106 cells/well) for 80 h and 1 µCi of [3H]thymidine was added during 16 h of the culture.Anchored PCR.
The following oligonucleotides were used: PC
F1,TTGGGAGTCAAAGTCGGTGAAC; C
out, AACAGGCAGAGGGTGCTGTC; C
in, CTGAGACCGAGGATCTTTTAAC; AP, GGCCACGCGTCGACTAGTACGGGIIGGGIIGG GIIG; AUAP, GGCCACGCGTCGACTAGTAC.
Total cellular RNA was extracted from the sorted thymocytes
using ISOGEN in the presence of 1 µl of Ethachinmate that facilitates the recovery of small amounts of nucleotides (both from
Nippon Gene, Tokyo, Japan). The first strand cDNA synthesis
primed with TCR C
-specific antisense oligonucleotide, PC
F1,
was carried out using SuperScriptTM II reverse transcriptase
(GIBCO BRL, Gaithersburg, MD) at 50°C. After treatment with
RNase H and RNase I at 37°C for 30 min, the first strand cDNA
was purified from unincorporated dNTPs and PC
F1 and was
subjected to homopolymeric tailing using terminal deoxynucleotidyl transferase and dCTP. With this dC-tailed cDNA, several
PCR were carried out using C
out and AP primers, under the
following condition: 94°C (2 min), 1 cycle; 94°C (1 min), 55°C
(1 min), and 72°C (2 min), 30 cycles; 72°C (5 min), 1 cycle.
Then, the first PCR products were mixed and subjected to the
second PCR using C
in and AUAP primers in the presence of
TaqStart antibody (CLONTECH Laboratories, Inc., Palo Alto, CA), under the following condition: 94°C (2 min), 1 cycle; 94°C (1 min), 57°C (1 min), and 72°C (2 min), 30 cycles; 72°C (5 min), 1 cycle. When cDNA without dC-tailing was used, no visible band was obtained after the second PCR (data not shown).
Cloning and Sequencing of Anchored PCR Products.
The mixture of the second PCR products was ligated to pGMT-T Easy Vector (Promega Corporation, Madison, WI) and was used for the subsequent transformation of DH5
. Each colony was picked up and cultured in LB medium (100 µl) at 37°C for 5 h using 96-well U bottom plates, then the supernatant was subjected to PCR
using AUAP and C
in2 (GAGACCGAGG ATCTTTTAACT)
primers, under the following condition: 94°C (30 s), 1 cycle;
95°C (30 s) 68°C (3 min), 25 cycles. After removal of excess
primers and dNTPs using centricon 100 (Amicon, Inc., Beverly,
MA), the purified PCR products were labeled with dye terminator cycle sequencing using C
seq primer (AGACCGAGGATCTTTTAACT) and were analyzed on an ABI PRISMTM
377 DNA sequencer (Perkin-Elmer Corporation, Foster City,
CA) according to standard protocols.
| |
Results |
|---|
|
|
|---|
52-68
Complex in Mice Lacking Endogenous MHC Class I and Class
II Expressions.
Earlier, we had reported three lines of
transgenic mice that had been developed by introducing
the gene encoding I-A
b chain covalently bound to E
52-68 into mice lacking both endogenous I-A
b and invariant
chains (DKO; reference 24). Evidence that the I-Ab molecule covalently bound to E
52-68 is expressed in these
transgenic lines as a single species was obtained by complete
inhibition by the mAb specific for I-Ab-E
52-68 complex
of staining with an anti-I-Ab reagent, the inability of transgenic spleen cells to present other I-Ab-binding peptides,
and the robust proliferative response of transgenic CD4+ T
cells to wild-type I-Ab molecules with a normal array of
self-peptides (24). In addition, a similar transgenic mouse
line developed by Ignatowicz et al. (20) has been shown by
the detailed analysis to present no other detectable self-peptides (26). However, we have found that CD4+CD8
thymocytes in these transgenic mice include NK1.1+ thymocytes that are selected by nonclassical MHC class I
molecules such as CD1 (35, 36). To purify CD4+CD8
thymocytes selected to mature on I-Ab-E
52-68 complex
from those selected by nonclassical and probably classical
MHC class I molecules, we introduced null mutation of
2-microglobulin required for MHC class I expression into
B2L DKO mice that expressed I-Ab-E
52-68 complex in
the thymus at an intermediate level and showed most effective CD4+ T cell differentiation among three lines (24). Finally, B2L transgenic mice or nontransgenic mice lacking
endogenous I-A
b, invariant chain, and
2-microglobulin
(B2L TKO and TKO) were developed and used in the
present study.
Although no definite CD4+CD8
thymocytes were observed in TKO mice lacking MHC class I and class II expression, significant numbers of CD4+CD8
thymocytes
were selected to mature on a single I-Ab-E
52-68 complex in B2L TKO, reaching a level of ~25% of that seen in
mice that express wild-type I-Ab molecules but lack
2-microglobulin expression (
20/0; Fig. 1 A). Although the
proportion of CD4+CD8
thymocytes in B2L TKO was
comparable to that in B2L DKO, CD4+CD8int thymocytes
markedly decreased in B2L TKO. Such a decrease, compared with DKO or C57BL/6 (B6) mice, was also found in
TKO and
20/0 mice. These observations are consistent
with the previous report (37), supporting the model that
CD4+CD8int population represents developing thymocytes
to CD4
CD8+ phenotype as well as those to CD4+CD8
phenotype (38). When NK1.1 expression was analyzed in
B2L DKO, around 10% of CD4+CD8
thymocytes expressed this surface marker. However, as we expected, CD4+CD8
NK1.1+ T cells were scarcely observed in the
thymus from B2L TKO (Fig. 1 B).
|
Thymocytes Selected to Mature on the I-Ab-
E
52-68 Complex Express Diverse TCR-
Chains with No
Obvious Structural Features.
In an attempt to assess the role
of self-peptides in shaping a mature T cell repertoire, we
first compared the TCR V
usages in CD4+CD8
thymocytes from B2L TKO with those from
20/0 mice, using
a panel of mAbs. Although the proportions of CD4+CD8
thymocytes expressing TCR V
4, 12, and 14 slightly increased in B2L TKO (V
4, 12.7 ± 0.5% vs. 8.3 ± 0.3%;
V
12, 3.7 ± 0.5% vs. 2.7 ± 0.1%; V
14, 12.7 ± 0.7% vs.
10.2 ± 0.2%), other TCR V
were similarly expressed on
CD4+CD8
thymocytes in these lines (data not shown).
In contrast to the availability of the mAbs specific for
TCR V
segments, only limited numbers of mAbs are
available for TCR V
s, some of which react with only the
subfamily of a particular TCR V
family. To overcome
this problem and thoroughly analyze the TCR-
repertoire, we sorted CD4+CD8
thymocytes and examined
TCR-
mRNA using anchored PCR followed by sequencing of the cloned PCR products. From B2L TKO
CD4+CD8
thymocytes, we obtained 97 clones originating from different templates, where 13 different V
families and 27 different J
segments were encoded. On the
other hand, we obtained from
20/0 CD4+CD8
thymocytes 71 independent TCR-
sequences that encoded
13 different V
families and 22 different J
segments.
When the V
and J
usages were compared, no remarkable difference was observed (Fig. 2 A and data not shown).
The distribution of CDR3 length showed Gaussian-like patterns in both cases (Fig. 2 B). In addition, no obvious
structural features in the CDR3 loops could be deduced,
even when clones from B2L TKO were analyzed (data not
shown). These results indicate that a single ligand, I-Ab-
E
52-68 complex, selects a quite diverse T cell repertoire.
|
52-68
Complex in the Presence of a Single Rearranged TCR-
chain.
The specificity of TCR for MHC-peptide ligands
is determined by both TCR-
and
chains. In light of the
low affinity interaction of TCR-
/
with MHC-peptide
ligands in positive selection (31), it would be difficult to visualize the imprint of selecting peptides on T cell repertoire
when TCR-
or TCR-
chains are separately analyzed,
even though selecting peptide is a single species. However, some structural imprints might be revealed, if TCR-
or
TCR-
chains were to be analyzed for CD4+CD8
thymocytes expressing a particular TCR-
or TCR-
with
irrelevant specificity for the selecting ligand. To test this
idea, we employed the transgenic mice expressing 2B4
TCR-
(V
3-D
1.1-J
1.2) derived from the TCR-
/
specific for moth cytochrome c peptide bound to I-Ek or I-Eb
molecules (7, 39), and, by crossing these mice with B2L TKO, developed TKO mice expressing both B2L transgene and the rearranged 2B4 TCR-
(B2L TKO/2B4
).
Although no CD4+CD8
thymocytes were observed in
TKO/2B4
mice lacking MHC class I and class II expression, significant numbers of CD4+CD8
thymocytes were
selected to mature in B2L TKO/2B4
and
20/0 mice expressing 2B4 TCR-
chain (
20/0/2B4
; Fig. 3 A). Lymph
node CD4+ T cells from B2L TKO/2B4
mice as well as
B2L TKO responded well to spleen cells from
20/0 or
C57BL/6 (B6) mice expressing wild-type I-Ab molecules
with self-peptides other than E
52-68, but did not show
any response to B2H TKO spleen cells that express I-Ab-
E
52-68 complex as a single species at higher level than
those from B2L TKO (24; Fig. 3 B). Taken together, these
observations suggest that positive and negative selection occurs normally in immature thymocytes expressing the essentially fixed 2B4 TCR-
and randomly rearranged
TCR-
in B2L TKO/2B4
mice.
|
When the expression of TCR V
3 was analyzed, 65-
75% of CD4+CD8
thymocytes from both B2L TKO/
2B4
and
20/0/2B4
mice expressed on their cell surface
TCR V
3 at a high level (Fig. 3 C). Considerable numbers
of CD4+CD8
V
3
and CD4+CD8
V
3int thymocytes
expressed TCR V
8 that is most frequently observed in
CD4+CD8
thymocytes from both B2L TKO and
20/0
mice (B2L TKO, 18.0 ± 0.4%;
20/0, 18.2 ± 0.5%),
whereas no definite expression of TCR V
8 was detected
on CD4+CD8
thymocytes expressing TCR V
3 at a
high level from both B2L TKO/2B4
and
20/0/2B4
(Fig. 3 C). These observations indicate that allelic exclusion by the transgenic 2B4 TCR-
is almost completed in
CD4+CD8
V
3hi thymocytes and suggest that these thymocytes exclusively express the transgene.
Chains on
CD4+CD8
Thymocytes Selected to Mature on the I-Ab-
E
52-68 Complex in the Presence of Transgenic 2B4 TCR-
.
With the strategy described above, we then compared
TCR-
chains expressed on CD4+CD8
V
3hi thymocytes from B2L TKO/2B4
with those from
20/0/
2B4
or B6 mice expressing both E
and 2B4 TCR-
chains (E
-B6/2B4
). In two independent experiments
using different B2L TKO/2B4
mice, 73 out of 109 clones
(67%) originating from different templates were found to
encode the V
18 family, and 42% of the remaining (15 of
36 clones) encoded the V
segment (denoted as 17.A2)
that was not observed in samples from
20/0/2B4
mice
but identical to that on a T cell clone reported by Mohapatra et al. (40; Fig. 4 A). In contrast to the results on B2L
TKO/2B4
mice, such restricted TCR V
usage was not
observed with clones obtained from E
-B6/2B4
or
20/0/
2B4
mice expressing wild-type I-Ab molecules with or
without I-Ab-E
52-68 complex, respectively, though the
TCR V
repertoire differed between these strains, probably because of the presence of I-Eb molecules in E
-B6/
2B4
mice. When the length of their CDR3 loops was
compared, the distribution pattern in B2L TKO/2B4
mice differed from those in
20/0/2B4
and E
-B6/2B4
(Fig. 4 B).
|
Having found that CD4+CD8
thymocytes selected to
mature on I-Ab-E
52-68 complex preferentially expressed
V
18 in the presence of the 2B4 TCR-
, we focused on
clones encoding this V
family and analyzed amino acid sequences of their CDR3 loops. Surprisingly, 70 of 73 clones
bearing V
18 from B2L TKO/2B4
mice encoded aspartic or glutamic acid at the first position of their CDR3
loops (
93; Table 1). In contrast, only 9 of 20 clones bearing V
18 from
20/0/2B4
encoded aspartic or glutamic
acid at
93, and 11 other clones encoded several amino
acid residues including tryptophan, alanine, arginine, proline,
valine, threonine, glycine, and leucine (Table 1). The V
18
family includes two subfamilies, AV18S1 and AV18S2, that
only differ by the amino acid residue at position 25:
AV18S1 encodes threonine at this position, whereas AV18S2
encodes lysine (41). Although the subfamily was not determined for 23 clones from B2L TKO/2B4
mice due to
shortness of the PCR products, 50 other clones encoded
AV18S2 and 48 clones of these encoded aspartic or
glutamic acid at
93. Because of the lack of complete information on the genomic sequence of AV18S2, we cannot
determine at this stage whether aspartic or glutamic acid at
this position is encoded by a germ line sequence or created
by a random nucleotide (N-region) addition. Nonetheless,
since the AV18S2-bearing TCR-
chains with various
amino acid residues at
93 were found in
20/0/2B4
, it is
suggested that, in B2L TKO/2B4
mice, there is a strong
selection to conserve or introduce negatively charged
amino acid residues at this position to survive the thymic
selection directed by a single I-Ab-E
52-68 ligand.
|
Since AV18S2 and V
17.A2 were the major V
gene
segments obtained from B2L TKO/2B4
, we compared
the NH2-terminal structure of these segments from the cysteine at position 90. As shown in Fig. 5 A, the predicted
amino acid sequences are highly conserved between these
V
gene segments (80.7%). The CDR1 and CDR2 loops of TCR-
chains have been suggested to play an important
role in interactions with MHC class II/peptide ligand (42). Although three amino acid substitutions are observed
in their CDR1 loops, the property of these amino acid residues is relatively conserved and the CDR2 loops show no
differences between AV18S2 and V
17.A2. Thus, it is
concluded that V
17.A2 encodes the V
chain that would be structurally related to that encoded by AV18S2. When
CDR3 loops were analyzed for 15 clones encoding
V
17.A2 from B2L TKO/2B4
mice, we again found that
11 clones encoded aspartic or glutamic acid at
93 (Fig. 5 B).
|
| |
Discussion |
|---|
|
|
|---|
In this study, we compared the TCR-
repertoire in
CD4+CD8
thymocytes selected to mature on a single
I-Ab-E
52-68 ligand with those selected by wild-type I-Ab
molecules with a normal array of self-peptides, in the presence or absence of a single rearranged TCR-
chain irrelevant to this selecting ligand, using anchored PCR followed
by sequencing of the PCR products. This method is based
on competitive PCR without using specific primers for
particular V
segments, so that PCR bias is minimized. In
addition, clones originating from different templates can be
distinguished by differences in the anchored position, even
when they encode the same TCR-
chains. Although the
frequencies of V
3 or V
8 usage in B2L TKO and
20/0
mice estimated using this approach were much higher than
frequencies assessed using the mAbs, RR3-16 or B21.14
(data not shown), this is likely the result of specificity of
these mAbs that react with only some of these subfamilies
(45, 46). On the other hand, the frequencies of V
2 usage
estimated by this approach in several mouse lines including
B2L TKO,
20/0, and B2L TKO/2B4
largely agreed with
frequencies observed with the flow cytometric analysis using the mAb, B20.1, that reacts with almost all subfamilies
(47; data not shown). Therefore, we conclude that heterogeneity of the anchored PCR products would reflect, to
some extent, the real diversity of TCR-
repertoire in
CD4+CD8
thymocytes.
By introducing the 2B4 TCR-
chain with irrelevant
specificity for the I-Ab-E
52-68 complex, CD4+CD8
thymocytes selected to mature on this single ligand expressed highly restricted TCR-
chains encoding V
18 or
its related sequence and negatively charged amino acid
residues at
93 in their CDR3 loops. Taking into consideration that multiple TCR-
rearrangements cease only
after positive selection (48, 49), a small number of clones
encoding TCR-
chains without such structural features might represent nonselectable in-frame rearrangements
(50). Alternatively, these clones might be derived from a
trace of CD4+CD8
V
3int thymocytes where allelic exclusion by 2B4 TCR-
is not accomplished. Since such
structural features of TCR-
chain were not observed with CD4+CD8
V
3hi thymocytes selected to mature in
20/0/2B4
mice expressing wild-type I-Ab molecules
with a normal array of self-peptides, it is clear that highly
restricted V
usage and amino acid residues at
93 in B2L TKO/2B4
mice does not result from efficient pairing of
particular TCR-
chains with 2B4 TCR-
as was previously reported (51, 52), but rather from thymic selection
directed by I-Ab-E
52-68 complex. We cannot determine
at this stage whether aspartic or glutamic acid at
93 is determined by the germ line sequence or created by the
N-region. However, it is suggested that both structural features in the V
gene segment and amino acid residue at
93 are independently required to survive thymic selection by this single ligand, because other V
gene segments, including AV10S6 that encodes aspartic acid at this position
in its germ line (41), are not preferentially expressed in
CD4+ CD8
V
3hi thymocytes from B2L TKO/2B4
mice and AV18S2-bearing clones from
20/0/2B4
mice
were found to encode various amino acid residues at this
position. We have shown that lymph node CD4+ T cells
from B2L TKO/2B4
mice acquire immunological tolerance to the I-Ab-E
52-68 complex, suggesting that the T
cell repertoire in this line is shaped through both positive
and negative selection directed by a I-Ab-E
52-68 ligand.
This might raise the possibility that developing thymocytes
expressing TCR-
chains other than those with the particular V
segments and CDR3 loops are eliminated in B2L
TKO/2B4
mice through interaction with I-Ab-E
52-68
complexes that are expressed in this line but not in
20/0/
2B4
mice. However, this possibility is unlikely, because
various TCR-
chains without such structural features
were found in CD4+CD8
V
3hi thymocytes from E
-B6/2B4
mice where I-Ab-E
52-68 complexes are expressed in the thymus, probably at higher level than that in
B2L TKO/2B4
(34). Therefore, it is suggested that the
structural features of TCR-
chains observed in B2L
TKO/2B4
mice are imprinted under the process of positive selection directed by I-Ab-E
52-68 complex.
Several groups recently reported that antigen-specific T
cells selected by a given MHC-peptide complex express
somewhat different TCR from those in normal mice, suggesting that selecting self-peptides influence mature T cell
repertoire (53). However, it is difficult from these experiments to precisely determine whether the altered T cell
repertoire mainly results from positive selection directed by
a particular MHC-peptide ligand or antigen-driven expansion of some T cells that would be deleted in normal mice
expressing the same MHC class II molecules at high level
in the thymus with a normal array of self-peptides, because
negative selection to wild-type MHC molecules was lacking in some experiments (54) or was ineffective (53, 55).
This issue was clarified in this study where CD4+CD8
thymocytes positively selected by a single I-Ab-E
52-68
ligand were directly analyzed for TCR-
chains expressed in association with 2B4 TCR-
. Our findings clearly indicate that self-peptides involved in positive selection influence structure of the variable gene segment and CDR3
loops of the selected TCR repertoire. In some antigen-specific TCR recognition, the amino acid residue at
93 has
been functionally or structurally shown to be involved in
peptide contact (56, 57). Thus, the highly restricted amino
acid residue at this position of TCR-
chains in B2L
TKO/2B4
mice strongly suggests that specific TCR-
peptide contacts are also involved in positive selection directed by I-Ab-E
52-68 complex. Since expression of the
I-Ab-E
52-68 complex was readily detected in the thymus
using a mAb specific for this complex (24), it is unlikely
that this contribution of E
52-68 to positive selection in
B2L TKO/2B4
mice is due to an extremely low expression of I-Ab molecules, which might cause a more stringent
requirement of specific selecting peptides than that under
physiological conditions. In addition, CD4+CD8
thymocytes in B2L TKO/2B4
mice, different from studies
using TCR-
/
transgenic mice, are selected from the semidiverse T cell repertoire with randomly rearranged TCR-
chains and the essentially fixed 2B4 TCR-
chain. Although further analysis needs to address whether self-peptides with amino acid residues bearing bulky or charged
side chains at positions facing TCR would mediate efficient positive selection, our findings on B2L TKO/2B4
mice provide definitive evidence that specific recognition
of self-peptides by TCR is involved in positive selection of
thymocytes and support the recent observation that the
amino acid composition of CDR3 loops analyzed for particular V
-J
segments in B2L DKO mice is slightly different from those in B6 mice (58).
Studies on crystallography of two MHC class I-peptide
complexes with their associated TCR-
/
have revealed
that five CDs both from TCR-
and TCR-
chains, except for TCR-
CDR2, directly interact with MHC class
I-peptide complex in a diagonal orientation (57, 59). Although no structural data are available for the interaction of
TCR-
/
with MHC class II-peptide complex, functional studies have suggested that a similar but not identical interaction also occurs in this case (43, 44). Since CDR1 and
CDR2 are determined by a variable segment itself, our
finding on B2L TKO/2B4
mice that developing thymocytes expressing TCR-
chains with particular V
segments and CDR3 loops are allowed to mature on a single
MHC-peptide ligand suggests that at least two good fits are
required for the interaction of TCR-
/
with a selecting
ligand to survive positive selection. Despite this requirement, however, TCR-
chains expressed on CD4+CD8
thymocytes from B2L TKO mice showed no obvious bias
in V
usage and amino acid composition of their CDR3
loops. By analyzing the affinity of TCR-
/
for positively
or negatively selecting MHC-peptide ligands in a cell-free
system, Alam et al. (31) have suggested that the affinity
window to survive both positive and negative selection is
quite narrow. Therefore, provided that a TCR-
chain has
CDR1 or CDR3 that fits with a selecting ligand, CDR of
the associated TCR-
chain on mature thymocytes would
be less characteristic, because not only of low affinity interaction sufficient for surviving positive selection but also of
negative selection of developing thymocytes expressing
TCR-
chains with good fits. Together with the degeneracy in recognition of peptides by TCR-
/
(60), this could
explain why B2L TKO/2B4
mice but not B2L TKO show
structural features in their mature TCR-
repertoire. Although the degree of this structural fitness for a selecting
MHC-peptide ligand would be affected by its cell surface
density in thymic cortex and medulla (17, 24, 61), the
partial fitness of TCR-
/
for their selecting peptide and/or
MHC molecule might be a general feature of the mature T
cell repertoire shaped by both positive and negative selection.
Although H-2M0/0 mice had been used to define the
role of particular self-peptides in positive selection (21,
25, 27), it has been shown that peptides other than CLIP
are bound to I-Ab molecules and contribute to the positive
selection of CD4+ thymocytes (26). By comparing a particular V
-J
segment in H-2M0/0 mice with that in H-2M0/+
in the presence of a single rearranged TCR-
chain,
Sant'Angelo et al. (30) recently reported that alteration of
self-peptides bound to I-Ab molecules affects CDR3 length
of the selected TCR-
repertoire. The somewhat biased
distribution of CDR3 length observed with the TCR-
repertoire in B2L TKO/2B4
mice largely supports their findings. However, it should be noted that homogeneity in
the CDR3 length in B2L TKO/2B4
mice depends on
the analyzed V
-J
segments: 12 out of 12 clones encoding V
17.A2-J
15 have the same CDR3 length, whereas
this is not the case with the V
18-J
20 segment where 16 clones have a CDR3 loop of 7 amino acids, 18 clones have a CDR3 loop of 8 amino acids, and 1 clone has a CDR3
loop of 9 amino acids. Therefore, different from the case
with antigen-driven T cell expansion (62, 63), our findings
in B2L TKO/2B4
mice suggest that homogeneity in the
CDR3 length does not serve as a hallmark of specific
TCR-peptide interaction in the positive selection of thymocytes. In addition, the TCR-
repertoire in B2L TKO/
2B4
mice, as compared with that in H-2M0/0 mice expressing the transgenic TCR-
chain, showed a stronger restriction to amino acid residue in the CDR3 loops. This
would result from differences in the expression level of I-Ab
molecules in the thymus and/or the diversity of selecting
peptides, that is single or heterogeneous. Furthermore, the
difference in the introduced TCR-
chain might affect the
outcome, because D10 TCR-
chain used in their experiment is derived from the I-Ab-reactive TCR-
/
(42).
In conclusion, we have shown that, by expression of a
single rearranged TCR-
chain with irrelevant specificity
for the selecting ligand, CD4+CD8
thymocytes selected
to mature on a single MHC class II-peptide ligand express
highly restricted TCR-
chains in terms of V
usage and
amino acid residue of their CDR3 loops, thereby providing evidence for specific recognition of self-peptides by
TCR-
/
in positive selection. Thus, our experimental
system made it feasible to visualize TCR structure required
for surviving positive selection directed by a single MHC-
peptide ligand. This approach would lead to the relevant
application for elucidation of topology of TCR-MHC-peptide interaction in positive selection.
| |
Footnotes |
|---|
Address correspondence to Takehiko Sasazuki, Kyushu University, Medical Institute of Bioregulation, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan. Phone: (81) 92-642-6828; Fax: (81) 92-632-0150; E-mail: sasazuki{at}bioreg.kyushu-u.ac.jp
Received for publication 20 April 1998 and in revised form 17 June 1998.
The authors thank Drs. D. Mathis and C. Benoist for mice deficient in wild-type I-A
b or invariant chain,
Dr. M.M. Davis for 2B4
transgenic mice, M. In and H. Kuriki for assistance with cell sorting, and M. Ohara for comments on the manuscript.
This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports, and Culture, Japan and the Japan Science and Technology Corporation.
Abbreviations used in this paper
20/0, mice lacking
2-microglobulin;
B2L or B2H, mouse lines expressing I-A
b chain covalently bound to
E
52-68;
B6, C57BL/6 mice;
CLIP, invariant chain-derived class II-associated peptide;
DKO, mice lacking endogenous I-A
b and invariant
chains;
E
52-68, E
-derived peptide;
E
-B6, C57BL/6 mice transgenic
for E
;
H-2M0/0, mice lacking H-2M expression;
TKO, mice lacking endogenous I-A
b, invariant chain, and
2-microglobulin;
TKO/2B4
, B2L TKO/2B4
,
20/0/2B4
, E
-B6/2B4
;
TKO, B2L TKO,
20/0
and E
-B6 mice expressing 2B4 TCR-
chain.
| |
References |
|---|
|
|
|---|
| 1. | Davis, M.M., and P.J. Bjorkman. 1988. T-cell antigen receptor genes and T-cell recognition. Nature. 334: 395-402 [Medline]. |
| 2. | Bevan, M.J.. 1977. In a radiation chimaera, host H-2 antigens determine immune responsiveness of donor cytotoxic cells. Nature. 269: 417-418 [Medline]. |
| 3. |
Zinkernagel, R.M.,
G.N. Callahan,
A. Althage,
S. Cooper,
P.A. Klein, and
J. Klein.
1978.
On the thymus in the differentiation of "H-2 self-recognition" by T cells: evidence for
dual recognition?
J. Exp. Med.
147:
882-896
|
| 4. | Kisielow, P., H.S. Teh, H. Blüthmann, and H. von Boehmer. 1988. Positive selection of antigen-specific T cells in thymus by restricting MHC molecules. Nature. 335: 730-733 [Medline]. |
| 5. | Sha, W.C., C.A. Nelson, R.D. Newberry, D.M. Kranz, J.H. Russell, and D.Y. Loh. 1988. Selective expression of an antigen receptor on CD8-bearing T lymphocytes in transgenic mice. Nature 335: 271-274 [Medline]. |
| 6. |
Teh, H.-S.,
P. Kisielow,
B. Scott,
H. Kishi,
Y. Uematsu,
H. Blüthmann, and
H. von Boehmer.
1988.
Thymic major histocompatibility complex antigens and the ![]() T-cell receptor
determine the CD4/CD8 phenotype of T cells.
Nature.
335:
229-233
[Medline].
|
| 7. |