|
||
By






From the * Laboratory of Molecular Immunology and the
Howard Hughes Medical Institute, The
Rockefeller University, New York 10021-6399; § Schering-Plough Laboratory for Immunobiology,
Dardilly 69571, France; the
Baylor Institute for Immunology Research, Sammons Cancer Center,
Dallas, Texas 75246; the ¶ Department of Immunology, The Tokyo Metropolitan Institute of Medical
Science, Tokyo 113, Japan; the ** Centre d'Immunologie de Marseille-Luminy, 13288 Marseille cedex
09, France; and the 
DNAX Research Institute, Palo Alto, California 94304-1104
| |
Abstract |
|---|
|
|
|---|
The germinal center (GC) is an anatomic compartment found in peripheral lymphoid organs, wherein B cells undergo clonal expansion, somatic mutation, switch recombination, and reactivate immunoglobulin gene V(D)J recombination. As a result of somatic mutation, some GC B cells develop higher affinity antibodies, whereas others suffer mutations that decrease affinity, and still others may become self-reactive. It has been proposed that secondary V(D)J rearrangements in GCs might rescue B cells whose receptors are damaged by somatic mutations. Here we present evidence that mature human tonsil B cells coexpress conventional light chains and recombination associated genes, and that they extinguish recombination activating gene and terminal deoxynucleotidyl transferase expression when their receptors are cross-linked. Thus, the response of the recombinase to receptor engagement in peripheral B cells is the opposite of the response in developing B cells to the same stimulus. These observations suggest that receptor revision is a mechanism for receptor diversification that is turned off when antigen receptors are cross-linked by the cognate antigen.
Key words: secondary V(D)J recombination; germinal center; recombination activating gene; surrogate light chain; terminal deoxynucleotidyl transferase| |
Introduction |
|---|
|
|
|---|
Blymphocytes develop clonally restricted antigen specific receptors by randomly joining Ig variable (V), diversity (D), and joining (J) gene segments by V(D)J recombination (1). V(D)J recombination is a highly regulated process that requires coordinate expression of a series of lymphoid-specific and non-lymphoid-specific genes (2). Among the lymphoid-restricted components, only recombination activating genes RAG11 and RAG2 are essential for V(D)J recombination (3). Together, these two proteins form a complex that initiates Ig genes rearrangements by recognizing the recombination signal sequences (RSSs) and cleaving DNA (7). There are three distinct waves of RAG expression in the bone marrow (14, 15). These waves of RAG expression correspond to heavy and light chain gene rearrangements and receptor editing (16).
In addition to RAG1 and RAG2, B cell progenitors also
express a series of other proteins that are developmentally
restricted, B cell specific, and required for efficient antibody gene assembly (19, 20). These include the terminal
deoxynucleotidyl transferase (TdT) and murine
5 or human
-like, and V-preB proteins. TdT increases antibody
diversity by adding nontemplated nucleotides to V(D)J
junctions (21, 22) whereas
5 and V-preB associate with
each other to form the surrogate light chain (
L) (23). The
L is believed to enhance the efficiency of B cell development by pairing with heavy chains before a conventional light chain is assembled. In the absence of
5, B cell
development is severely impaired at the pro-B cell to pre-B
cell transition because pro-B cells that express a heavy chain
in the absence of a light chain are unable to develop into
pre-B cells (23). Expression of all of these genes is
thought to be terminated before mature B cells exit the bone
marrow, ensuring that each B cell produces a single fixed
antigen receptor that can be clonally selected and expanded in the periphery in response to specific antigen (19, 20).
Clonal expansion of specific antigen receptor-bearing B cells occurs in the germinal center (GC) (27). During the GC reaction, B cells with low affinity antigen receptors can improve the affinity of their receptors by somatic hypermutation (30). In addition, mouse GC B cells have been shown to be able to reactivate V(D)J recombination (33). The finding that V(D)J recombination occurs in mature B cells was unexpected because V gene rearrangements alter antibody specificity, and clonal selection implies that cells expanded in the GC retain their specificity. However, if appropriately regulated, new recombination might function to rescue B cells that make deleterious somatic mutations, or serve as an alternative mechanism to somatic mutation for producing cells with high affinity antibodies.
Here, we report experiments that show V(D)J rearrangement in mature peripheral B cells in humans and that suggest that recombination in these cells is regulated by antigen receptor cross-linking.
| |
Materials and Methods |
|---|
|
|
|---|
Human Cell Isolation and Fractionation.
Tonsil B cells and B cell subsets were prepared as previously described (38). In brief, after depletion of non-B cells, tonsil mononuclear cells were stained with biotin-labeled goat anti-human IgD (Amersham Pharmacia Biotech, Piscataway, NJ), which was visualized with streptavidin-FITC (Immunotech, Westbrook, ME), and PE-labeled mouse anti-human CD38 (Becton Dickinson, San Jose, CA). Cells were then sorted into the following fractions: (a) IgD+CD38
follicular mantle (FM) B cells; (b) IgD
CD38+ GC B cells; and (c)
IgD
CD38
memory B cells. Alternatively, tonsil mononuclear
cells were stained with PE-labeled mouse anti-human CD38
(Becton Dickinson) and rat anti-human CD77 (Immunotech)
that was visualized with FITC-labeled sheep anti-rat IgM (Serotec, Ltd., Kidlington, UK) and sorted into three fractions: (a)
CD38+CD77+ centroblasts; (b) CD38+CD77
centrocytes; and
(c) a CD38
CD77
fraction that contained both naive FM B cells
and memory B cells. To analyze for V-preB expression, tonsil
cells were stained with tricolor anti-CD38 (Caltag Labs., San
Francisco, CA), PE-labeled IgG1 monoclonal anti-V-preB antibody (4G7) (Schiff, C., manuscript in preparation), and FITC labeled anti-IgM (DAKO Corp., Carpinteria, CA), or anti-
(DAKO Corp.) and/or anti-
(Ortho Diagnostic Systems, Raritan, NJ) mAb.
Cell Culture.
Human FM and GC B cells were maintained in tissue culture as previously reported (38). In brief, 5 × 105 cells were cocultured during 3 d with CD40L-transfected L cells and stimulated with: IL-2 (10 U/ml), or IL-4 (50 U/ml), or IL-10 (100 ng/ml) or anti-
, or anti-
, or both, or Fab'2 anti-
+ anti-
, or irrelevant control IgG, at the indicated concentrations in micrograms per milliliter (Kallestad Lab., Inc., Austin, TX).
Linker-ligation PCR.
DNA was extracted from 2 × 106 cells in agarose plugs (35) and ligated to the BW linker at 20 pM as previously described (39). PCR was performed using AmpliTaq Gold Taq polymerase (PE Applied Biosystems, Foster City, CA). In the first round of PCR we used linker primer BW-1 or BW-1H (39) and either JH6-1 or J
5-1 (JH6-1, 5'GCTGGTCTGGGGTGACCTCTCTCCGCTTC3'; J
5-1, 5'CAAACGTAAGTGCACTTTCCTAATGC3'). Samples were amplified for
15 cycles of 40 s at 94°C, 40 s at 66°C, and 1 min at 72°C, followed by a final 10-min extension step at 72°C. 1 µl was then used
for an additional 40 cycles of PCR containing a second nested locus-specific primer (JH6-2, 5'GTGGTGGGACTCTGTCCGCTCCAAGGC3'; J
5-2, 5'GTTTGAGATATTAGCTCAGGTCAATTC3') and either BW-1 or the closely related BW-1H
linker primers (39). The expected size for the specific JH6 or J
5
RSS signal break products are 322 and 249 bp, respectively. Control PCR assays used the J
5-R primer specific for the human J
5
coding exon (J
5-R, 5'GTTTAATCTCCAGTCGTGTCCCTTG3') combined with J
5-2 to amplify a germline 260-bp internal Ig
locus fragment from the same linker-ligated DNA
samples. PCR products were analyzed on 2% agarose gels and hybridized with either JH6 or J
5 internal probes (JH6, 5'GCTTGCGGTTGGACTTCCCAGCCGACAGTGGTGGTCTGGCTTCTGA3'; J
5, 5'GAACAGCCAAGCGCTAGCCAGTTAAGTGAGGCATCTCAATTGCAAG3').
Cloning and Sequencing.
PCR products were gel purified with the Qiaquick kit (QIAGEN Inc., Chatsworth, CA) and cloned using the TA cloning system (Invitrogen Corp., Carlsbad, CA). Double-stranded DNA sequences were obtained using T7 and M13 primers with a Dye Terminator Cycle Sequencing kit (PE Applied Biosystems). The sequencing reactions were run and analyzed on a genetic analyzer (model 310; PE Applied Biosystems).RNA Preparation and Reverse Transcriptase PCR.
Total RNA was extracted from 2 × 105 cells using TRIzol Reagent (GIBCO BRL, Gaithersburg, MD) and reverse transcribed in 20 µl with Superscript II (GIBCO BRL). For reverse transcriptase (RT)-PCR reactions, 2 µl of cDNA were amplified for 26, 28, or 30 (Ig
,
-like, and V-preB) or 36, 38, or 40 (RAG1, RAG2, and TdT)
cycles of 30 s at 94°C, 30 s at 60°C and 30 s at 72°C with a final
10-min extension at 72°C using Platinum Taq DNA polymerase (GIBCO BRL) and the following primers: RAG1 sense
5'TGCAGACATCTCAACACTTTGG3', antisense 5'ACATCTGCCTTCACATCGATCC3'; RAG2 sense exon 1A 5'AGCAGCCCCTCTGGCCTTCAG3', exon 1B 5'CCTTCAGACTGCGGTCTCCAG3', antisense 5'TCCCTCGGCTGTACACCACATTAATG3'; TdT sense 5'GACACCACCAGATGGGCCAGCCAGAG3', antisense 5'TGTTCTCTGCTACAATGTGGGTGAC3'; Ig
sense 5'ATGGCCAGGCTGGCGTTGTCTC3',
antisense 5'GAGGCGCTGTTCATGTAGCAGTG3'. Since human RAG2 transcripts derive from two different alternative first
exons, RT-PCR was done with two 5' primers specific for exon
1A or exon 1B. Amplification of either of the two possible mature mRNAs results in the same size product.
-like- and
V-preB-specific primers have been previously described (40).
RT-PCR products were analyzed on 2% agarose gels and hybridized with cognate cDNAs amplified from the human pro-B cell line
JEA-2, which expresses all these transcripts (40). PhosphorImager
analysis was performed on samples amplified in the linear range.
Analysis of Mouse Cells.
4-6-wk-old
5 targeted mice (41)
and C57Bl/6 controls were bred and maintained under specific
pathogen-free conditions. Mice were immunized with 50 µg of
NP-CGG in alum 10 d before analysis. Spleen cells from immunized mice were stained with allophycocyanin-labeled anti-B220,
PE-labeled anti-
, PE-labeled anti-
-1 and -2, FITC-labeled anti-GL7 (PharMingen, San Diego, CA), and biotin-labeled
LM34 or SL156 anti-
5 antibodies (42) visualized with streptavidin-PerCP (Becton Dickinson). Four-color analysis was performed on a FACScalibur® using Cellquest 3.1 (Becton Dickinson).
Immunohistochemistry.
Acetone-fixed cryostat tonsil sections (5 µm) were incubated with primary mouse mAbs against V-preB (4G7) (Schiff, C., manuscript in preparation), followed by Alexa488-conjugated goat anti-mouse Ig (Molecular Probes, Eugene, OR), and/or anti-CD21 mAb (DAKO Corp.) followed by biotinylated horse anti-mouse IgG (Vector Labs., Burlingame, CA) and Texas red-conjugated streptavidin (Molecular Probes). Confocal laser scanning microscopy was performed along the x and y axes with a confocal laser scanning microscope (Leica Inc., Deerfield, IL) equipped with an ×20 oil objective.| |
Results and Discussion |
|---|
|
|
|---|
To study the regulation of V(D)J recombination in peripheral B cells, we turned to human tonsils as a source of
large numbers of B cells that are readily fractionated into
naive FM B cells and GC B cells (38). To determine
whether human GC B cells actively undergo V(D)J recombination we developed an assay for detecting blunt 5' phosphorylated human Igµ and Ig
RSS signal ends which are
specific intermediate products of the V(D)J recombination reaction (references 39, 43; Fig. 1 a). JH6 and J
5 were selected because both are at the 3' ends of their respective J
regions and are least likely to be deleted during V(D)J recombination in the bone marrow. Using this assay PCR
products corresponding to the expected 5' phosphorylated
human JH6 and J
5 signal ends were readily detected in human bone marrow, and were verified as specific by cloning
and sequencing (Fig. 1 b, and data not shown).
|
Having established the validity of the assay we examined
B cells from tonsils fractionated into IgD+CD38
naive
FM B cells, and IgD
CD38+ GC cells. We found no RSS
signal breaks in the naive FM B cells (Fig. 1 b). In contrast,
GC B cells displayed Ig
but no Igµ RSS signal breaks.
The number of Ig
RSS breaks in GC B cells could not be
determined precisely because the RSS break assay involves a less than stoichiometric ligation reaction and two rounds
of amplification. Nevertheless, the amount DNA breaking
detected in GC samples was always 5-10-fold lower than
in bone marrow as determined by dilution. We conclude
that human GC B cells are actively undergoing V(D)J recombination at the Ig
locus.
The absence of Igµ RSS breaks in GC B cells may be due to the 12/23 rule. DH segments are 12/23 compatible with both VH and JH gene segments, but all DH segments are deleted by any V to DJH joining event. VH to JH joining is prohibited in the absence of DH segments by 12/23 incompatible RSSs (1). All mature B cells carry at least one productive VDJH on one allele and in addition many B cells have a nonproductive VDJH on the second allele (44). Thus, there is a relative dearth of potential 12/23 compatible targets for recombination at the heavy chain locus. Consistent with this idea, heavy chain RSS breaks can be found in activated B cells when DH segments are artificially preserved by allelic exclusion in mice that carry targeted VH genes (35). VH gene recombination using internal cryptic heptamers as signals for recombination has been documented but would not be detected by our assay (45, 46).
Immunohistochemistry revealed that mouse RAG1 protein expression is most prominent in the GC light zone,
suggesting that recombination is activated in centrocytes
(33). To determine whether expression of other recombinase
components is restricted to a specific subset of mature B
cells, we separated human tonsil B lymphocytes into five fractions by cell sorting: (a) FM cells, IgD+CD38
; (b) mixed
FM cells and memory B cells, CD38
CD77
; (c) total GC
B cells, IgD
CD38+; (d) GC centroblasts CD38+CD77+;
and (e) GC centrocytes, CD38+CD77
(38). Centroblasts
are rapidly dividing early GC cells that initiate somatic mutation, whereas switch recombination occurs primarily in
the centrocyte fraction that is derived from the centroblasts
(38, 47). RAG1, RAG2, TdT,
-like, and V-preB were
not expressed in resting FM B cells or in mixtures of FM B
cells and post-GC memory B cells (Fig. 2). In contrast, all of these mRNAs were found in the GC fraction and
RAG1, RAG2, and TdT were specifically enriched in centrocytes (Fig. 2). Although the PCR assay we used is only
semiquantitative, it is in the linear range and shows that the
levels of RAG1, RAG2, TdT,
-like, and V-preB mRNAs
in centrocytes are comparable to the levels of these mRNAs
found in unfractionated adult bone marrow samples as
measured by phosphorimaging. Low levels of RAG1 were
also found in centroblasts (20% of the levels in centrocytes
by phosphorimaging), but RAG2 was not detected in these
cells (Fig. 2). In accordance with the RAG mRNA expression data, Ig
RSS breaks were found in centrocytes and
not in centroblasts (Fig. 1 b). Thus, receptor revision by secondary V(D)J recombination is found in B cells that
have already passed through the centroblast stage where somatic mutation is initiated (38).
|
In developing B cells in the bone marrow,
-like and
V-preB proteins associate with each other as
Ls that
combine with nascent heavy chains to form the pre-B cell
receptor (42, 48). The number of human bone marrow
cells that express surface
L is very small (1-3% of B cells;
references 40, 48, 49). Nevertheless, in both mouse and
human, B cell development is inefficient in the absence of
the
L (41, 50), presumably due to loss of B cells that express a heavy chain but no light chain.
L may play a similar role in the GC B cell. According to this hypothesis,
L
would combine with heavy chains to rescue GC B cells
that have lost conventional light chain expression (33, 34,
37). To characterize the GC B cells that reexpress
L, we
stained human tonsil lymphocytes with anti-V-preB antibodies in conjunction with anti-CD38, anti-Ig
, and anti-Ig
antibodies (Fig. 3 a). Surface V-preB expression was
found on 0.85-11% of CD38+ GC B cells in six independent samples (both ends of the spectrum are shown in Fig.
3 a), whereas CD38
cells did not express V-preB (Fig. 3
a). In all cases, GC cells that expressed V-preB co-expressed
either Ig
or Ig
(Fig. 3 a and data not shown). The low
number of
L-positive cells in most of the human GC
samples is reminiscent of the low levels of
L on the surface of human bone marrow cells (40, 48, 49). In contrast
to the human,
L are readily detected on the surface of
mouse B cells in the bone marrow (42). To confirm our
findings in human cells, we examined mouse spleen B cells
for
5 expression using two different anti-
5 antibodies
(reference 42; Fig. 3 b). In immunized mice, 15-20% of
B220+GL7+ B cells expressed cell surface
5 (five consecutive experiments), and, as in humans, these cells coexpressed either
or
light chains (Fig. 3 b). The relative absence of variability in
L expression on mouse peripheral
B cells as compared with human may be due to controlled
immunizations and the use of inbred mouse strains. Control B220+GL7
non-GC B cells did not express surface
Ls and neither did B220+GL7+ B cells from
5 targeted
mice (Fig. 3 b). Furthermore,
Ls are coexpressed with
RAGs in B220+GL7+ B cells as determined by cell sorting
and RT-PCR analysis (data not shown). We conclude that
Ls are coexpressed with conventional light chains in
GL7+ mature spleen B cells in mice and human, and that
loss of conventional light chains is not a prerequisite for activation of
L expression in these cells.
|
GC B cells may not be the only peripheral B cells that
are CD38+IgD
(38). To directly confirm that
Ls are expressed in GC B cells, we stained human tonsil tissue sections with anti-CD21 and anti-V-preB antibodies. Consistent with the cell fractionation experiments,
L expression
was found in GCs (Fig. 4). In addition, occasional
L-positive B cells were found in the mantle and T cell zones. These occasional
L-positive cells represent CD38+IgD
non-GC B cells because isolated CD38
IgD+ FM B cells are
always
L negative as measured by immunofluorescence (data not shown).
L expressing non-GC CD38+IgD
B
cells may be recent bone marrow immigrants that are
CD38+IgM+IgD
. We conclude that
Ls are expressed in
human GC B cells but are also expressed in other tonsillar
B cells.
|
To define the requirements for RAG induction in peripheral B cells, we cocultured purified IgD+CD38
FM
and IgD
CD38+ GC B cells with fibroblasts that express
CD40L and ILs (51). After 3 d of culture with CD40L,
resting FM B cells were induced to express high levels of
TdT mRNA, but did not express RAG1, RAG2,
-like,
or V-preB (Fig. 5 a). IgD
CD38+ B cells differ from FM B
cells in that they express RAG1, RAG2,
-like, and
V-preB, and all of these mRNAs are maintained in cocultures of GC B cells and CD40L-expressing fibroblasts (Figs.
2 and 5, a and b). Consistent with the results obtained with
FM cells, only TdT mRNA expression is upregulated in
the GC B cells in culture (Fig. 5 a). Addition of IL-2, IL-4,
or IL-10 was not sufficient for RAG induction in the resting FM B cells, and did not alter the levels of RAGs or
TdT expressed by GC B cells (Fig. 5 a). These results are in
contrast to experiments with mouse spleen B cells that appeared to be induced to express RAGs in response to
CD40L plus IL-4 or LPS plus IL-4 (35, 36). We conclude that reinduction of TdT in mature human B cells is mediated through CD40, and that distinct pathways are required
to activate RAG expression.
|
Immature autoreactive IgM+IgD- bone marrow B cells
can be induced to reexpress RAGs when their receptors are
cross-linked by self-antigens (15, 52). Reexpression of
RAGs in these self-reactive B cells has been shown to delete
the auto-reactive receptors, and this process is referred to as
receptor editing (16). To determine whether RAG expression in peripheral B cells could also be modulated by
receptor cross-linking, we added anti-
and anti-
(anti-
+
) antibodies to cultured IgD+CD38
and IgD
CD38+
B cells (Fig. 5, a and b). In contrast to the activation of RAG expression in bone marrow B cells, addition of anti-B cell
receptor (BCR) antibodies to cultured peripheral B cells inhibited the expression of RAG1, RAG2, and TdT (Fig. 5,
a and b). Anti-
+
antibodies also downregulated CD40L-induced TdT expression in FM cells (Fig. 5 a). To further
characterize the suppressive effect of anti-BCR antibodies
on RAG expression, we performed dose-response experiments with both intact anti-
+
antibodies and Fab'2
fragments as well as control nonspecific antibody preparations (Fig. 5 b). mRNA levels were measured by semiquantitative RT-PCR and phosphorimaging. RAG1 and
RAG2 downregulation was observed with 10 µg/ml of intact anti-
+
and as little as 2 µg/ml of Fab'2 fragments of
anti-
+
antibody but was difficult to detect with 10 µg/ml
of intact anti-
or anti-
alone (RAG1 expression was decreased by a factor of 6-8 after treatment with 10 µg/ml of
intact anti-
+
antibody, and up to 20× after treatment
with 10 µg/ml of Fab'2 fragments of anti-
+
; Fig. 5 b).
Direct measurements of cell viability showed that addition
of either intact or Fab'2 fragments of anti-
+
antibodies
to the cultures did not result in increased cell death (see
legend to Fig. 5). More importantly, FACS® analysis
showed that the number cells undergoing "neoteny" (33) did not change after anti-BCR cross-linking as determined
by anti-V-preB staining and confirmed by RT-PCR analysis of V-preB mRNA levels (Fig. 5, a-c). Thus, the effects
of anti-BCR antibodies on RAG expression cannot be explained by preferential killing of the specific subset of GC B
cells that are undergoing receptor revision (36). We conclude that the effect of receptor cross-linking on recombination-associated gene expression in peripheral B cells is
the opposite of the effect of cross-linking the same receptor on immature IgM+IgD
bone marrow B cells (15).
What is the function of receptor revision in the periphery? Our experiments indicate that new antigen receptor assembly does not require light chain inactivation and is not likely to be a mechanism for removing autoreactive receptors (Figs. 3 and 5). On the contrary, activation of recombination in cells that fail to bind antigen suggests that secondary recombination may participate in repertoire diversification by improving very low affinity receptors (35, 36). Expression of TdT lends further support to the notion that new receptor diversification by gene recombination occurs in mature B cells in the periphery since the only known function for TdT is to increase the diversity in the repertoire by adding N nucleotides to V(D)J junctions (21, 22).
The idea that specific antibodies might be induced during an immune response is difficult to accept because it is directly contradictory to current interpretations of the clonal selection theory (53, 54). Nevertheless, receptor assembly in GC B cells is already a well established mechanism for antibody diversification in avian immune systems (55). In the chicken, Ig gene conversion is a prominent feature of the GC reaction, resulting in groups of interrelated clones of B cells (55). In mice and humans, Ig recombination in GC B cells may be limited to the light chain genes. Since much of the antibody-binding pocket is shaped by the heavy chain, changing just the light chain could result in a group of related B cells with antibodies that have a spectrum of antigen binding affinities. Our findings are consistent with the idea that secondary recombination is terminated when antigen receptors are cross-linked and suggest a mechanism for positive selection of B cells that produce high affinity receptors by receptor revision in the periphery.
| |
Footnotes |
|---|
Address correspondence to Michel C. Nussenzweig, Laboratory of Molecular Immunology, Howard Hughes Medical Institute, The Rockefeller University, New York, NY 10021. Phone: 212-327-8067; Fax: 212-327-8370; E-mail: nussen{at}rockvax.rockefeller.edu
Received for publication 29 May 1998.
E. Meffre was supported by a grant from the Philippe Foundation, and P. Cohen by National Institutes of Health (NIH) Medical Scientist Training Program grant GM-77039. This work was supported by grants from the NIH to M.C. Nussenzweig. M.C. Nussenzweig is an associate investigator of the Howard Hughes Medical Institute.We thank members of the Nussenzweig lab for comments on the manuscript and helpful discussions, and Dr. Jim Young for help obtaining bone marrow samples.
Abbreviations used in this paper
GC, germinal center;
FM, follicular mantle;
L, surrogate light chain;
LM, ligation-mediated;
RAG, recombination activating gene;
RSS, recombination signal sequences;
RT, reverse
transcriptase;
TdT, terminal deoxynucleotidyl transferase.
| |
References |
|---|
|
|
|---|
| 1. | Tonegawa, S.. 1983. Somatic generation of antibody diversity. Nature. 302: 575-581 [Medline]. |
| 2. | Willerford, D.M., W. Swat, and F.W. Alt. 1996. Developmental regulation of V(D)J recombination and lymphocyte differentiation. Curr. Opin. Genet. Dev. 6: 603-609 [Medline]. |
| 3. | Schatz, D.G., M.A. Oettinger, and D. Baltimore. 1989. The V(D)J recombination activating gene, RAG-1. Cell. 59: 1035-1048 [Medline]. |
| 4. |
Oettinger, M.A.,
D.G. Schatz,
C. Gorka, and
D. Baltimore.
1990.
RAG-1 and RAG-2, adjacent genes that synergistically
activate V(D)J recombination.
Science.
248:
1517-1523
|
| 5. | Shinkai, Y., G. Rathbun, K.-P. Lam, E.M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A.M. Stall, and F.W. Alt. 1992. RAG-2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 68: 855-867 [Medline]. |
| 6. | Mombaerts, P., J. Iacomini, R.S. Johnson, K. Herrup, S. Tonegawa, and V.E. Papaioannou. 1992. RAG-1 deficient mice have no mature B and T lymphocytes. Cell. 68: 869-877 [Medline]. |
| 7. | Hiom, K., and M. Gellert. 1996. A stable RAG-1-RAG-2- DNA complex that is active in V(D)J cleavage. Cell. 88: 65-72 . |
| 8. | McBlane, J.F., D.C. van Gent, D.A. Ramsden, C. Romeo, C.A. Cuomo, M. Gellert, and M.A. Oettinger. 1995. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps. Cell. 83: 387-395 [Medline]. |
| 9. | van Gent, D.C., J.F. McBlane, D.A. Ramsdem, M.J. Sadofsky, J.A. Hesse, and M. Gellert. 1995. Initiation of V(D)J recombination in a cell-free system. Cell. 81: 925-934 [Medline]. |
| 10. | Cuomo, C.A., C.L. Mundy, and M.A. Oettinger. 1996. DNA sequence and structure requirements for cleavage of recombination signal sequences. Mol. Cell. Biol. 16: 5683-5690 [Abstract]. |
| 11. | Difilippantonio, M.J., C.J. McMahan, Q.M. Eastman, E. Spanopoulou, and D. Schatz. 1996. RAG1 mediates signal sequence recognition and recruitment of RAG2 in V(D)J recombination. Cell. 87: 253-262 [Medline]. |
| 12. | Spanopoulou, E., F. Zaitseta, F.-H. Wang, S. Santagata, D. Baltimore, and G. Panayotou. 1996. The homeodomain region of Rag-1 reveals the parallel mechanisms of bacterial and V(D)J recombination. Cell. 87: 263-276 [Medline]. |
| 13. | Ramsden, D.A., J.F. McBlane, D.C. van Gent, and M. Gellert. 1996. Distinct DNA sequence and structure requirement for the two steps of V(D)J recombination signal cleavage. EMBO (Eur. Mol. Biol. Organ.) J. 15: 3197-3206 [Medline]. |
| 14. | Grawunder, U., T.M.J. Leu, D.G. Schatz, A. Werner, A.G. Rolink, F. Melchers, and T.H. Winkler. 1995. Down-regulation of RAG1 and RAG2 gene expression in preB cells after functional immunoglobulin heavy chain rearrangement. Immunity. 3: 601-608 [Medline]. |
| 15. |
Hertz, M., and
D. Nemazee.
1997.
BCR ligation induces receptor editing in IgM+IgD bone marrow B cells in vitro.
Immunity.
6:
429-436
[Medline].
|
| 16. |
Tiegs, S.L.,
D.M. Russell, and
D. Nemazee.
1993.
Receptor
editing in self-reactive bone marrow B cells.
J. Exp. Med.
177:
1009-1020
|
| 17. |
Radic, M.Z.,
J. Erickson,
S. Litwin, and
M. Weigert.
1993.
B lymphocytes may escape tolerance by revising their antigen
receptors.
J. Exp. Med.
177:
1165-1173
|
| 18. |
Gay, D.,
T. Saunders,
S. Camper, and
M. Weigert.
1993.
Receptor editing: an approach by autoreactive B cells to escape tolerance.
J. Exp. Med.
177:
999-1008
|
| 19. | Rajewsky, K.. 1996. Clonal selection and learning in the antibody system. Nature. 381: 751-758 [Medline]. |
| 20. | Rolink, A., and F. Melchers. 1991. Molecular and cellular origins of B lymphocyte diversity. Cell. 66: 1081-1094 [Medline]. |
| 21. |
Gilfillan, S.,
A. Dierich,
M. Lemeur,
C. Benoist, and
D. Mathis.
1993.
Mice lacking TdT: mature animals with an immature lymphocyte repertoire.
Science.
261:
1175-1178
|
| 22. |
Komori, T.,
A. Okada,
V. Stewart, and
F.W. Alt.
1993.
Lack
of N regions of antigen receptor variable region genes of
TdT-deficient lymphocytes.
Science.
261:
1171-1175
|
| 23. |
Pillai, S., and
D. Baltimore.
1987.
Formation of disulfide-linked µ2 2 tetramers in pre-B cells by the 18k -immunoglobulin light chain.
Nature.
329:
172-174
[Medline].
|
| 24. |
Karasuyama, H.,
A. Kudo, and
F. Melchers.
1990.
The proteins encoded by the VpreB and 5 pre-B cell-specific genes
can associate with each other and with µ heavy chain.
J. Exp.
Med.
172:
969-972
|
| 25. |
Tsubata, T., and
M. Reth.
1990.
The products of pre-B cell-
specific genes ( 5 and VpreB) and the immunoglobulin µ chain
form a complex that is transported onto the cell surface.
J.
Exp. Med.
172:
973-976
|
| 26. |
Nishimoto, N.,
H. Kubagawa,
T. Ohno,
G.L. Gartland,
A.K. Stankovic, and
M.D. Cooper.
1991.
Normal pre-B cells express a receptor complex of µ heavy chains and surrogate
light-chain proteins.
Proc. Natl. Acad. Sci. USA.
88:
6284-6288
|
| 27. | MacLennan, I.C.. 1994. Germinal centers. Annu. Rev. Immunol. 12: 117-139 [Medline]. |
| 28. | Nossal, G.J.. 1994. Differentiation of the secondary B-lymphocyte repertoire: the germinal center reaction. Immunol. Rev. 137: 173-183 [Medline]. |
| 29. | Kelsoe, G.. 1996. The germinal center: a crucible for lymphocyte selection. Semin. Immunol. 8: 179-184 [Medline]. |
| 30. | Weigert, M.G., I.M. Cesari, S.J. Yonkovich, and M. Cohn. 1970. Variability in the lambda light chain sequences of mouse antibody. Nature. 228: 1045-1047 [Medline]. |
| 31. | Berek, C., A. Berger, and M. Apel. 1991. Maturation of the immune response in germinal centers. Cell. 67: 1121-1129 [Medline]. |
| 32. | Jacob, J., G. Kelsoe, K. Rajewsky, and U. Weiss. 1991. Intraclonal generation of antibody mutants in germinal centres. Nature. 354: 389-392 [Medline]. |
| 33. |
Han, S.,
B. Zheng,
D.G. Schatz,
E. Spanopoulou, and
G. Kelsoe.
1996.
Neoteny in lymphocytes: Rag1 and Rag2 expression in germinal center B cells.
Science.
274:
2094-2097
|
| 34. |
Hikida, M.,
M. Mori,
T. Takai,
K. Tomochika,
K. Hamatani, and
H. Ohmori.
1996.
Reexpression of RAG-1 and
RAG-2 genes in activated mature mouse B cells.
Science.
274:
2092-2094
|
| 35. |
Papavasiliou, F.,
R. Casellas,
X.F. Qin,
E. Besmer,
H. Suh,
R. Pelanda,
D. Nemazee,
K. Rajewsky, and
M.C. Nussenzweig.
1997.
V(D)J recombination in mature B cells: a new
mechanism for diversification of antibody responses.
Science.
278:
298-301
|
| 36. |
Han, S.,
S.R. Dillon,
B. Zheng,
M. Shimoda,
M.S. Schlissel, and
G. Kelsoe.
1997.
V(D)J recombinase activity in a subset
of germinal center B lymphocytes.
Science.
278:
301-305
|
| 37. | Hikida, M., M. Mori, T. Kawabata, T. Takai, and H. Ohmori. 1997. Characterization of B cells expressing recombination activating genes in germinal centers of immunized mouse lymph nodes. J. Immunol. 158: 2509-2512 [Abstract]. |
| 38. |
Pascual, V.,
Y.-J. Liu,
A. Magalski,
O. de Bouteiller,
J. Banchereau, and
J.D. Capra.
1994.
Analysis of somatic mutation in five B cell subsets of human tonsil.
J. Exp. Med.
180:
329-339
|
| 39. |
Schlissel, M.,
A. Constantinescu,
T. Morrow,
M. Baxter, and
A. Peng.
1993.
Double-strand signal sequence breaks in
V(D)J recombination are blunt, 5'-phosphorylated, RAG-dependent, and cell cycle regulated.
Genes Dev.
7:
2520-2532
|
| 40. |
Meffre, E.,
M. Fougereau,
J.-N. Argenson,
J.-M. Aubaniac, and
C. Schiff.
1996.
Cell surface expression of surrogate light
chain ( L) in the absence of µ on human pro-B cell lines
and normal pro-B cells.
Eur. J. Immunol.
26:
2172-2180
[Medline].
|
| 41. |
Kitamura, D.,
A. Kudo,
S. Schaal,
W. Muller,
F. Melchers, and
K. Rajewsky.
1992.
A critical role of 5 protein in B cell
development.
Cell.
69:
823-831
[Medline].
|
| 42. |
Karasuyama, H.,
A. Rolink,
Y. Shinkai,
F. Young,
F.W. Alt, and
F. Melchers.
1994.
The expression of VpreB/ 5 surrogate light chain in early bone marrow precursor B cells of
normal and B cell deficient mutant mice.
Cell.
77:
133-143
[Medline].
|
| 43. |
Roth, D.B.,
C. Zhu, and
M. Gellert.
1993.
Characterization
of broken DNA molecules associated with V(D)J recombination.
Proc. Natl. Acad. Sci. USA.
90:
10788-10792
|
| 44. | Ehlich, A., V. Martin, W. Muller, and K. Rajewsky. 1994. Analysis of the B cell progenitor compartment at the level of single cells. Curr. Biol. 4: 573-583 [Medline]. |
| 45. | Reth, M., P. Gehrmann, E. Petrac, and P. Wiese. 1986. A novel VH to VHDJH joining mechanism in heavy-chain-negative (null) pre-B cells results in heavy-chain production. Nature. 322: 840-842 [Medline]. |
| 46. | Kleinfield, R., R.R. Hardy, D. Tarlinton, J. Dangl, L.A. Herzenberg, and M. Weigert. 1986. Recombination between an expressed immunoglobulin heavy-chain gene and germline variable gene segment in a Ly 1+ B-cell lymphoma. Nature. 322: 843-846 [Medline]. |
| 47. | Liu, Y.J., F. Malisan, O. de Bouteiller, C. Guret, S. Lebecque, J. Banchereau, F.C. Mills, E.E. Max, and H. Martinez-Valdez. 1996. Within germinal centers, isotype switching of immunoglobulin genes occurs after the onset of somatic mutation. Immunity. 4: 241-250 [Medline]. |
| 48. | Lassoued, K., C.A. Nunez, L. Billips, H. Kubagawa, R.C. Monteiro, T.W. LeBien, and M.D. Cooper. 1993. Expression of surrogate light chain receptors is restricted to a late stage in pre-B cell differentiation. Cell. 73: 73-86 [Medline]. |
| 49. |
Ghia, P.,
E. ten Boekel,
E. Sanz,
A. de la Hera,
A. Rolink, and
F. Melchers.
1996.
Ordering of human bone marrow B
lymphocyte precursors by single-cell polymerase chain reaction analyses of the rearrangement status of the immunoglobulin H and L chain loci.
J. Exp. Med.
184:
2217-2229
|
| 50. |
Minegishi, Y.,
E. Coustan-Smith,
Y.-H. Wang,
M.D. Cooper,
D. Campana, and
M.E. Conley.
1998.
Mutations in the
human 5/14.1 gene result in B cell deficiency and agammaglobulinemia.
J. Exp. Med.
187:
71-77
|
| 51. |
Arpin, C.,
J. Dechanet,
C. Van Kooten,
P. Merville,
G. Grouard,
F. Briere,
J. Banchereau, and
Y.-J. Liu.
1995.
Generation
of memory B cells and plasma cells in vitro.
Science.
268:
720-722
|
| 52. | Melamed, D., R.J. Benschop, J.C. Cambier, and D. Nemazee. 1998. Developmental regulation of B lymphocyte immune tolerance compartmentalizes clonal selection from receptor selection. Cell. 92: 173-182 [Medline]. |
| 53. | Burnet, F.M. 1959. The Clonal Selection Theory Of Acquired Immunity. The University Press, Cambridge, UK. |
| 54. |
Talmage, D.W..
1959.
Clonal selection theory.
Science.
129:
1643-1648
|
| 55. | Arakawa, H., S. Furusawa, S. Ekino, and H. Yamagishi. 1996. Immunoglobulin gene hyperconversion ongoing in chicken splenic germinal centers. EMBO (Eur. Mol. Biol. Organ.) J. 15: 2540-2546 [Medline]. |
This article has been cited by other articles: