|
||
By
§







From the * Emory Vaccine Center, Viral infections often induce potent CD8 T cell responses that play a key role in antiviral immunity. After viral clearance, the vast majority of the expanded CD8 T cells undergo apoptosis, leaving behind a stable number of memory cells. The relationship between the CD8 T cells
that clear the acute viral infection and the long-lived CD8 memory pool remaining in the individual is not fully understood. To address this issue, we examined the T cell receptor (TCR)
repertoire of virus-specific CD8 T cells in the mouse model of infection with lymphocytic
choriomeningitis virus (LCMV) using three approaches: (a) in vivo quantitative TCR CD8+ T cells play a key role in the control and clearance of viral infections, and contribute to antiviral immunological memory (1). These lymphocytes recognize viral antigens presented in the context of self MHC class I
molecules at the surface of infected cells. The T cell antigen
receptor (TCR) is a membrane-bound heterodimer composed of The TCR repertoire of antiviral CTL responses has been
studied for various systems in humans (8, 11), monkeys
(14), and mice (15). Some of these analyses concluded
or suggested that a limited subset of V segments are used by
the CTLs responding to a given epitope. Conversely, other
studies reported a broad TCR repertoire in the antiviral
CTL response they analyzed (20, 21). Lymphocytic choriomeningitis virus (LCMV) infections in mice give rise to
substantial CD8 T cell expansions, and at the peak of the
response, >50% of the CD8 T cells are LCMV-specific (25). The TCR repertoire of the CTL response to LCMV
infections has been studied for two different mouse strains.
In C57BL/6 mice, TCR sequence of a few clones directed
to one viral epitope (GP276-286) suggested usage of a limited number of V segments (16, 17). In BALB/c mice,
where the CTL response is essentially directed against a single immunodominant Ld-restricted epitope (26), one study
(21) reported isolation of three clones each using different V segment combinations: V The T cell response to LCMV infection of mice occurs
in three phases. First, there is a massive expansion of CD8+
T cells, with maximal numbers apparent at day 8 after infection. Second, a substantial decline of this population occurs, and >90% of the responding cells undergo apoptosis
between days 8 and 30; and third, there is a period of long-term memory, with a stable number of memory CD8 T
cells persisting for the life of the mouse (1, 31). Secondary
infection of LCMV-immune mice results in rapid expansion of CTL effectors from the memory pool. These CD8
T cells expedite viral clearance and are the mediators of the
protective immunity (1, 31). The links between the CD8 effector population at the peak of the primary response and
the memory pool residing in the individual after viral clearance are not fully understood. One way to examine the relationship between primary effectors and memory cells, or
between memory cells and secondary effectors, is to monitor their clonotypic composition by TCR repertoire analysis. Comparative study of TCR usage provides direct insight into the selection processes shaping T cell memory and anamnestic responses. These issues have been partially
addressed in various systems. The CD8 T cell response to
Listeria monocytogenes infection in mice was examined by
functional TCR fingerprinting (32). That study found that
TCR usage for one epitope was similar among primary effectors, memory T cell pool, and secondary effectors based
on recognition patterns of alanine-substituted peptides. The T cell selection mechanisms have also been examined
in the response to pigeon cytochrome C (PCC) and HLA-Cw3 (9, 10). McHeyzer-Williams and Davis (9) reported
TCR repertoire narrowing in the secondary CD4 T cell
response to PCC compared with the primary response,
whereas Maryanski et al. (10) found no difference between
the primary and secondary CD8 T cell responses to mouse tumor cell lines expressing HLA-Cw3.
In this study, the TCR repertoire of the CTL response
to LCMV infection in BALB/c mice was examined directly by analysis of V Virus Infection and Mice.
Department of Microbiology and
Immunology, Emory University, Atlanta, Georgia 30322; the § Centre d'Etudes du Bouchet, 91710 Vert-le-Petit, France; the
Unité de Biologie Moléculaire du Gène, Institut Pasteur, 75724 Paris cedex
15, France; and ¶ Epimmune, San Diego, California 92121
![]()
Abstract
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
chain
V segment and complementarity determining region 3 (CDR3) length repertoire analysis by
spectratyping (immunoscope); (b) identification of LCMV-specific CD8 T cells with MHC
class I tetramers containing viral peptide and costaining with TCR V
-specific antibodies; and
(c) functional TCR fingerprinting based on recognition of variant peptides. We compared the
repertoire of CD8 T cells responding to acute primary and secondary LCMV infections, together with that of virus-specific memory T cells in immune mice. Our analysis showed that
CD8 T cells from several V
families participated in the anti-LCMV response directed to the
dominant cytotoxic T lymphocyte (CTL) epitope (NP118-126). However, the bulk (~70%) of
this CTL response was due to three privileged T cell populations systematically expanding during
LCMV infection. Approximately 30% of the response consisted of V
10+ CD8 T cells with a
chain CDR3 length of nine amino acids, and 40% consisted of V
8.1+ (
CDR3 = eight amino
acids) and V
8.2+ cells (
CDR3 = six amino acids). Finally, we showed that the TCR repertoire of the primary antiviral CD8 T cell response was similar both structurally and functionally
to that of the memory pool and the secondary CD8 T cell effectors. These results suggest a stochastic selection of memory cells from the pool of CD8 T cells activated during primary infection.
![]()
Introduction
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
and
chains. Each chain is encoded by a series of rearranged segments termed variable (V),1 diversity (D),
joining (J), and constant (C) (2, 3). The broad diversity of
the TCR repertoire results from the numerous possible
V-D-J (or V-J in
chains) combinations, from random mutations or nucleotide additions at the D-J and V-D (or
V-J in
chains) junctions, and from the random pairing of
separately recombined
and
chains. As in Igs, the most
diverse portion of the TCR is the CDR3 of the
chain,
which encompasses the V-D-J junctional area. It has been
proposed (4) that this loop makes direct contacts with
the peptide-MHC complex, and recent crystallographic studies support this notion (7). The length of the CDR3
has been shown to be a major determinant of antigen recognition (8), suggesting that the loop length influences
the docking of the TCR with its ligand. Due to the broad
diversity in the TCR repertoire, only a subset of all available T cells can recognize one given epitope. Direct examination of the TCR enables antigen-specific cells to be
identified and tracked during immunization or infections. TCR usage also acts as a signature of the ongoing immune
response and can be used to compare different expanding T
cell subsets. For instance, comparative study of the primary
antiviral T cell response and memory pool can be accomplished by TCR repertoire analysis.
1/V
10, V
3/V
6, and
V
2/V
7. The report concluded that there was marked diversity in the responding TCR repertoire. However, all
of these analyses, like most studies of the TCR repertoire
in antiviral CTL responses, relied on isolation and in vitro
expansion of lymphocytes, a step prone to introduce important biases in the TCR usage (27).
segment and CDR3 length distribution without any in vitro cell manipulation. We found
systematic expansion of three subsets of T cells. We
showed that these subsets were antigen-specific, as assayed
by surface staining with soluble tetrameric MHC-peptide complexes, intracellular staining for IFN-
, and functional
assays on sorted cells. The three privileged T cell populations expanding upon infection were shown to account for
70% of the total LCMV-specific CD8+ T cells. The repertoire of acute primary effectors proved to be structurally
and functionally similar to that of the memory pool remaining in the individual after viral clearance, and to the
TCR repertoire of secondary effectors triggered by reinfection with LCMV. The implications of the magnitude and
the kinetics of expansion and decline of these virus-specific
T cell populations, as well as their role in immunological
memory, are discussed.
![]()
Materials and Methods
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Flow Cytometry and FACS® Analysis.
All the antibodies used in this study were purchased from PharMingen (San Diego, CA). Single cell suspensions of spleen were prepared, and 106 cells were stained in PBS containing 1% BSA and 0.02% sodium azide (FACS® buffer) for 30 min at 4°C followed by three washes in FACS® buffer. Samples were acquired on either a FACScan® flow cytometer or FACSCalibur® instrument (Becton Dickinson, San Jose, CA). For sorting purposes, 3 × 108 cells were incubated in 5 ml with 60 µg of anti-CD8 and anti-V
10 antibodies for 30 min at
4°C in RPMI 1640 medium supplemented with 10% FCS. The
cells were then washed once in the same buffer and processed immediately on a FACSVantage® sorter (Becton Dickinson). All
data were analyzed using CellQuest software (Becton Dickinson).
Intracellular IFN-
Stain.
stain, we used FITC-conjugated rat anti- mouse IFN-
mAb (clone XMG 1.2) and its isotype control Ab
(rat IgG1; both from PharMingen).
In experiments analyzing IFN-
production and TCR V
usage (see Fig. 5) after stimulation with specific peptide, there was substantial downregulation of the TCR. Because of this TCR
downregulation, the staining pattern of antigen-specific CD8 T
cells was not clearly defined. For better staining of the activated
CD8 T cells, we used a high concentration of biotinylated anti-V
8.1-8.2 or -V
10 Ab (4 µg per 106 cells in 100 µl vol) and
subsequently added Cy-chrome-coupled streptavidin (PharMingen) to further amplify the signal.
|
Enzyme-linked Immunospot Assay for IFN-
-secreting Cells.
Ab (clone R4-6A2; PharMingen), and responder cells were added into the wells
along with 5 × 105
-irradiated syngeneic feeder cells. Cells were
incubated for 36 h either in the presence or absence of peptide
stimulation (0.1 µg peptide/ml). The amino acid sequences of
peptides used have been described (35, 36). After the culture,
plates were washed followed by incubation with biotinylated
anti-mouse IFN-
Ab (clone XMG 1.2; PharMingen). Spots
were developed using freshly prepared substrate buffer (0.03%
[wt/vol] 3-amino-9-ethyl-carbazole, 0.015% [vol/vol] H202 in
0.1 M sodium acetate, pH 5). Using this assay, we could accurately measure a minimum of 10 spots in 106 responder cells.
Preparation of H-2Ld Tetramers.
H2-Ld tetramers were prepared as described by Murali-Krishna et al. (25). In brief, bacterial expression of Ld and human
2-microglobulin was driven from
pET23-Ld-BSP and pHN1-
2m vectors in Escherichia coli strain
BL21(DE3). Folding was performed in the presence of NP118-
126 peptide. Purification by ionic exchange was followed by in
vitro biotinylation using purified BirA enzyme. Tetramers were
assembled by mixing biotinylated Ld-NP118-126 monomeric
complexes with fluorophore-conjugated avidin.
Ex Vivo CTL Assay and Limiting Dilution Assay.
Cytotoxic activity was tested in a standard 6-h 51Cr-release assay as described previously (33). Targets were coated with peptide at a concentration of 0.1 µg/ml. Limiting dilution analysis (LDA) was performed as described previously (31, 35).Immunoscope Analysis.
Immunoscope analyses were performed as described by Pannetier et al. (37, 38). In brief, single cell suspensions of individual spleens were prepared, and total RNA was extracted. The cDNA synthesis was primed with a (dT)15 oligonucleotide. An array of 24 PCR reactions was then performed with oligonucleotide C
2 (GCCAGAAGGTAGCAGAGACCC) and 24 unique V
-specific primers (see reference 37 for sequences). Then 24 run-off reactions were done using fluorescent primer
C
5' (CTTGGGTGGAGTCACATTTCTC). After analysis on
an automated sequencer (model 377; Applied Biosystems, Inc.,
Foster City, CA), the repertoire profile (i.e., the distribution of
the
chains in the various CDR3 lengths for each V
) was calculated with Immunoscope version 1.0 software (38).
| |
Results |
|---|
|
|
|---|
10+, V
8.1+, and V
8.2+ T Cells.
During the course of an acute LCMV infection in BALB/c
mice, the total number of activated CD8+ splenocytes increases dramatically (>10-fold) during the first 8 d, then
declines to reach a stable level after an additional 2-4 wk
(25, 31, 39). To identify these T cells expanding in response to LCMV, we performed a quantitative in vivo
TCR repertoire analysis. We used the immunoscope approach (also referred to as "spectratyping"; references 30,
37, 38, and 40). With this technique, the TCR repertoire can be broken down into 21 subrepertoires (one for
each functional V
segment [37]), which are analyzed individually. The CDR3 length profiles of all functional TCR
V
genes are determined by specific reverse transcription PCR. For each of these segments, the profile acts as a density function or a histogram, giving the relative abundance
in vivo of T cells using each possible CDR3 length. With
this compartmentalized approach, immune responses are
monitored by the CDR3 profile changes they induce in
each V
subrepertoire. Variations in the profiles result
from oligoclonal expansion or deletion of T cells using particular V
/CDR3 length combinations.
With this approach, we compared the TCR repertoires
of naive mice and mice at the peak of an acute LCMV infection. Total splenocytes were harvested from naive
BALB/c mice and from animals at day 8 after LCMV
infection. Previous studies (37) have shown that in naive
mice of various strains, the profiles show successive peaks
separated by three bases (i.e., one codon). The heights of
these peaks follow Gaussian-like curves centered on an average CDR3 length specific for each V
segment. As expected from these previous studies, we observed such
shapes for the CDR3 length profiles in the naive BALB/c
TCR repertoire (Fig. 1). At day 8 after LCMV infection,
the CDR3 profile of 18 out of the 21 V
subrepertoires remained relatively unchanged as exemplified by the V
4
profiles. In contrast, the CDR3 profiles of the remaining three V
segments showed very reproducible strong distortions in all the LCMV-infected mice, a characteristic of
"public responses" (30, 45). As shown in Fig. 1, striking
public responses to LCMV in BALB/c mice occurred in
the V
10, V
8.1, and V
8.2 subrepertoires. Each of these
three profiles showed expansion of T cell populations using
chains of a privileged CDR3 length: V
10+, CDR3 = nine amino acids; V
8.1, CDR3 = eight amino acids; and V
8.2, CDR3 = six amino acids. At day 8 after infection,
the area of the major expanded peaks (CDR3 lengths)
showed that these populations accounted for 50-70% of
the entire V
10 subrepertoire, 30-40% of the V
8.1 subrepertoire, and 20-30% of the V
8.2 repertoire. This
highly reproducible feature prompted us to better characterize both structurally and functionally these public immune responses to LCMV infection.
|
10+CD8+ and V
8.1-8.2+CD8+ Cell Populations Parallel the Expansion and Decline of CD8 T Cells during the
Course of LCMV Infection.
Using V
-specific mAbs, we
followed V
10+ and V
8.1-8.2+ T cells by FACS® analysis during the course of an acute LCMV infection in
BALB/c mice. Splenocytes were harvested at successive
time points after LCMV infection (days 3, 5, 8, 15, 39, 68, and 270 after infection) and surface-stained for CD8 or
CD4, and LFA1 (as an activation marker), as well as V
10,
V
8.1-8.2, or V
4 (as a negative control). Since the
V
10, V
8.1, and V
8.2 public responses were observed on total splenocytes, the distortion of the CDR3 length
profiles could have been due to either or both CD4+ and
CD8+ T cell expansions. The surface stains showed that no
particular CD4+V
10+ or CD4+V
8.1-8.2+ T cell expansion occurred during the course of infection (data not
shown). However, as shown in Fig. 2, the CD8+V
10+
and CD8+V
8.1-8.2+ T cell populations increased dramatically during the first 8 d, then declined to reach stable
levels after 1 mo. Direct comparison of Fig. 2, A, C, and D
shows that the expansion and contraction of the total
CD8+, V
10+CD8+, and V
8.1-8.2+CD8+ T cell populations followed parallel courses. The expansion was visible
as early as day 3 after infection. When it reached its peak at
day 8, the CD8+V
10+ and CD8+V
8.1-8.2+ T cell population numbers were 10- and 5-fold higher, respectively, than in a naive BALB/c mouse. As expected from immunoscope analysis, where no public response was observed
such as for the V
4 segment, FACS® analysis did not show
a substantial V
4+ T cell expansion (Fig. 2 B).
|
The activation status of the expanding cells was examined by staining for LFA1 (CD11a). Fig. 3 A shows that at
the peak of the response, >80% of the V
10+ and V
8.1-
8.2+CD8+ T cells were activated. These numbers match
the proportions of expanded populations measured by immunoscope. Even in immune mice, there was a substantial
proportion of LFA1high cells among these two V
families.
As a result, the CD8+LFA1high lymphocyte pool was enriched in V
10+ and V
8.1-8.2+ T cells (Fig. 3 B).
|
10+ and V
8.1-8.2+ Cells Account for 70% of All
LCMV-specific CD8+ T Cells.
The fact that after LCMV
infection, the proportions of both V
10+ and V
8.1-8.2+
cells differ between activated and nonactivated CD8+ populations, together with the observed bias for particular
CDR3 lengths, imply that the T cell repertoire differs between the expanding activated and resting nonactivated
CD8+ populations. This structural feature could be due to
the selective growth of T cells specific for LCMV. To test
this hypothesis, we examined the specificity of the expanding cells with several structural and functional assays.
The CD8+ response of BALB/c mice to acute LCMV
infection is almost entirely (i.e., >96% of the CD8+ T
cells) directed towards the NP118-126 immunodominant
epitope presented by the Ld molecule (25, 26). We took
advantage of this feature to identify virus-specific T cells by
staining with Ld-NP118-126 MHC class I tetramers (25,
46). Splenocytes were harvested from naive and LCMV-infected BALB/c mice, and stained with CD8 and TCR
V
-specific antibodies together with Ld-NP118-126 tetramers. Examples of these costains are shown in Fig. 4 A.
At the peak of the response, 50-55% of the total CD8+ T
cells recognized the immunodominant NP118-126 epitope.
The overall V
usage in the repertoire of the NP118-126-specific pool is summarized in Fig. 4 B and compared with
the V
usage in the non-antigen-specific CD8+ pool in
acute mice or in the CD8+ population of a naive mouse.
While the non-LCMV-specific CD8+ repertoire was similar to that of a naive mouse, the V
usage of the CD8+ T
cells binding to Ld-NP118-126 tetramers was strongly biased. At the peak of the response, the spleen contained
~2.4 × 107 CD8+ lymphocytes. Therefore, ~1.3 × 107
cells were LCMV NP118-126-specific, of which 30% (3.9 × 106 cells) were V
10+ and almost 40% (5.2 × 106 cells)
were V
8.1-8.2+ (Fig. 4, A and B). Thus, the bulk of the
response at day 8 after infection used only three different
V
segments. Therefore, the TCR repertoire in the
LCMV-specific population was narrow relative to the non-antigen-specific CD8+ pool in the same animals. Moreover, ~60% of all CD8+V
8.1-8.2+ cells and 85% of all
V
10+CD8+ lymphocytes were directed against NP118-
126 (Fig. 4 A). This frequency matches the magnitude of
the massive public responses within these V
subrepertoires observed by CDR3 length profile analysis.
|
To confirm our analysis of V
usage in the response to
the single immunodominant NP118-126 epitope, we used
a functional assay for antigen specificity. Detection of IFN-
secretion upon specific antigenic stimulation was performed by anticytokine intracellular staining at day 8 after
LCMV infection. Once harvested, the splenocytes were
stimulated in vitro for 5 h in the presence or absence of NP118-126 peptide. The cells were subsequently surface-stained for CD8 and V
10 or V
8.1-8.2, and intracellular
stain for IFN-
was then performed. Fig. 5 shows that 74%
of the V
10+CD8+ cells and 55% of the V
8.1-8.2+CD8+
cells responded to 5 h of stimulation with NP118-126 by
secreting IFN-
and downregulating TCR levels. In this
functional assay, V
10+CD8+ and V
8.1-8.2+CD8+ cells
accounted for 32 and 36%, respectively, of the total anti-LCMV CD8 response. These figures match the proportions
obtained by flow cytometry on cells stained with Ld-NP118-
126 tetramers.
To further confirm the massive anti-LCMV CD8+ response in the V
10+ subrepertoire, we performed functional assays on sorted V
10+CD8+ and V
10
CD8+
populations. 6-wk-old BALB/c mice were infected with
LCMV and killed at day 8 after infection. Splenocytes were
harvested, pooled, and surface-stained for CD8 and V
10.
The V
10+CD8+ and V
10
CD8+ populations were
then sorted, and were found to be 91 and 99% pure, respectively, after sorting. For each sorted population, as well
as unsorted total splenocytes, the frequency of cells producing IFN-
after stimulation by the NP118-126 peptide was measured by ELISPOT assay. As shown in Fig. 6 A, at day
8 after LCMV infection, >60% of the V
10+CD8+ lymphocytes secreted IFN-
after stimulation with NP118-
126 peptide. The frequency of NP118-126-specific T cells
was ~2.5 times lower in the V
10
CD8+ population. We
also performed an LDA on these two sorted cell populations to measure the frequency of NP118-126-specific
CTL precursors. As shown in Fig. 6 C, the frequency was
about fourfold higher in the V
10+CD8+ population than
in the V
10
CD8+ population, a ratio consistent with the
cytokine ELISPOT data (Fig. 6 A).
|
Although the CD8+ response to LCMV in BALB/c
mice is essentially directed against NP118-126, a response
to the Kd-restricted subdominant GP283-292 epitope can
also be detected at day 8 after infection, yet at a far lower
level (<1% of the total antiviral response; references 35 and
36). We used this feature of the BALB/c immune response
as a control in our functional characterization of V
10+
CD8+ and V
10
CD8+ isolated populations. As shown in
Fig. 6 B, all of the GP283-292-specific cells were found
among V
10
CD8+ splenocytes. This result shows that
while highly responsive to the Ld-restricted NP118-126
stimulus, the V
10+CD8+ population is ignorant of the
Kd-restricted GP283-292 subdominant epitope.
These functional assays on sorted cells, together with the
MHC class I tetramer staining and the intracellular staining
for IFN-
, all show that most of the V
10+CD8+ T and a
majority of the V
8.1-8.2+CD8+ cells were functionally
specific for the NP118-126 immunodominant peptide.
TCR repertoire
analysis provided us with a means to monitor LCMV-specific T cells in BALB/c mice. Having used it to analyze the
primary CD8+ T cell response to LCMV, we applied this
approach to characterize virus-specific T cells in the memory pool. Splenocytes from LCMV-immune mice (between days 39 and 68 after infection) were stained with Ld-NP118-126 tetramers to identify antigen-specific cells and
costained with CD8 and a panel of V
-specific antibodies.
The results of these analyses are summarized in Fig. 7 B,
and representative FACS® profiles for selected V
families
are shown in Fig. 7 A. The TCR usage of NP118-126-specific CD8+ T cells in immune mice was strikingly similar to the pattern seen during the primary response (day 8).
V
8.1-8.2+ and V
10+ cells again accounted for the majority of LCMV-specific memory CD8+ T cells, and the
overall hierarchy of TCR usage of memory CD8+ T cells
was similar to the effector population at day 8 (Fig. 7 B).
Since the absolute numbers of NP118-126-specific CD8+
T cells in immune mice was ~10-fold lower than the
numbers at the peak of the primary response, the results in
Fig. 7 show that TCR usage did not play a major role in
determining which LCMV-specific CD8+ T cells died and
which survived to go into the memory pool.
|
We next examined the TCR usage of LCMV-specific
CD8+ T cells during a secondary response. Immune mice
were rechallenged with LCMV, and at the peak of the anamnestic response (day 5 after infection), in vivo TCR repertoire analysis was done by staining with Ld-NP118-126
tetramers and V
-specific antibodies, and also by determining V
/CDR3 length profiles by immunoscope. As shown
in Fig. 7, A and B, major expansions again occurred in
LCMV-specific CD8+ T cells expressing V
10 or V
8.1-
8.2. The overall TCR usage of the virus-specific secondary
response was similar to the primary response and the memory T cell pool. Moreover, the CDR3 length analysis (Fig.
8) showed, as in the primary infection, that three striking
oligoclonal responses were apparent: V
10+, CDR3 = nine amino acids; V
8.1, CDR3 = eight amino acids; and V
8.2, CDR3 = six amino acids. Also, similar to the primary response, only limited distortions of the CDR3
length profile were observed for the other V
segments, as
exemplified by the profile for V
4 (Fig. 8).
|
The above data provided structural evidence that LCMV-specific primary, memory, and secondary CD8+ T cell
responses were similar. We also needed some functional confirmation that the LCMV-specific T cell repertoire comprised similar subsets of clones during the acute primary response, in the T cell memory pool remaining after viral
clearance, and during secondary infection. To this end, we
examined the TCR functional fingerprints of these three T
cell populations by variant peptide analysis. In this approach, single point mutations are introduced in the
epitope, and their impact on T cell recognition is measured by functional assays (32, 47). Variant peptides derived
from the wild-type LCMV NP118-126 sequence (RPQA-
SGVYM) were synthesized with single amino acid substitutions. All positions but the two known anchor residues
(positions 2 and 9) were tested. Mutations in positions 3, 5, 6, and 8 appeared to affect TCR contact without abolishing the binding of the peptide to Ld (data not shown). A set
of mutant peptides was used to stimulate splenocytes from
acute, immune, or rechallenged mice. The cells were then
stained for surface markers CD8, V
10, and V
8.1-8.2 as
well as intracellular IFN-
. Since the substituted peptides retain substantial affinity for Ld, the variations in T cell activation, as measured by IFN-
secretion, reflect the impact
of each mutation on TCR recognition. Fig. 9 A shows the
compilation of these measurements for total CD8+ T cells.
The fingerprints obtained by intracellular staining for IFN-
were similar between primary effectors and memory cells. The profile also remained comparable for secondary effectors. As a control, standard cytolytic assays were used for
primary and secondary effectors to verify that the mutations
affected cytotoxicity to the same extent as IFN-
secretion
(data not shown). Fig. 9, B and C, shows fingerprint analyses of CD8+ T cells expressing V
10 or V
8.1-8.2. Comparison of the fingerprints of the NP118-126-specific
V
10+ and V
8.1-8.2+ populations within any individual
mouse showed that although comparable, the fingerprints
of these two populations were not identical. Whenever a
mutation inhibited TCR recognition, its effect was stronger on V
10+CD8+ cells than on V
8.1-8.2+ T lymphocytes. These different profiles for V
10+ and V
8.1-8.2+
validated our technical approach and confirmed that the inhibitory mutations on positions 3, 5, 6, and 8 were affecting TCR contact residues. As shown in Fig. 9, B and C,
both for CD8+V
10+ and CD8+V
8.1-8.2+ populations,
the profiles were well conserved between the acute response (top) and the memory pool (middle). These fingerprints show that the memory pool remaining after viral
clearance is functionally similar to the primary CTL effector population. The fingerprints of the effectors during anamnestic response to reinfection (bottom) were also close to
those of acute primary T cell effectors or memory CD8+ T
cell pool, although the impact of mutations in the NP118-
126 epitope seemed slightly stronger for the V
10+CD8+
secondary response.
|
| |
Discussion |
|---|
|
|
|---|
In this report, we have structurally and functionally defined the CD8+ T cell populations responding to acute LCMV infection in BALB/c mice. Our studies have clearly shown that three oligoclonal populations comprise up to 70% of the CD8+ T cell response to LCMV infection. Moreover, by comparing the LCMV-specific T cell population during primary infection, at the memory stage, and during secondary reinfections, we have demonstrated that the acute CD8+ effector response and the memory T cell pool use a similar TCR repertoire.
A Limited CD8 T Cell Repertoire Responds to Acute LCMV Infection by Undergoing Massive Expansion.Combining surface staining with fluorescent MHC-peptide tetramers and
the immunoscope approach, we quantitatively examined the
in vivo T cell immune response to LCMV infection in the
BALB/c mouse. Out of the 168 V
segment/CDR3 length
possible combinations (45), three were used predominantly:
V
10+, CDR3 = nine amino acids; V
8.1, CDR3 = eight amino acids; and V
8.2, CDR3 = six amino acids.
They accounted for 70% of the antiviral CTL response.
This high expansion of a few limited subsets of clones distorted the responding CD8+ T cell repertoire and narrowed its complexity. Such predictable use of TCR segments by antigen-specific T cells has been observed in
other systems (30, 45) and termed "public response" by analogy with true public B cell clones. However, several
analyses performed in mice (30, 50, 51) have shown that although T cells involved in the same public response use the
same V
segment and have identical
chain CDR3
lengths, they may use different
chains and also different
J
and D
segments. Although variations in the V-D-J recombination processes probably lead to naive repertoires that are not strictly identical from mouse to mouse, the frequency of rearrangements coding for CDR3 peptidic sequences similar enough to be recruited in a particular public response remains high. Preliminary results (D. Sourdive,
unpublished data) show that several different J
segments
are used by the LCMV-specific V
10+CD8+ as well as
V
8.2+CD8+ T cells. Therefore, the CDR3 peptidic sequence of the responding cells is degenerated. We propose
that this relaxed sequence requirement for T cells using the
{V
10+, CDR3 = 9 amino acids}, {V
8.1, CDR3 = 8 amino acids}, or {V
8.2, CDR3 = 6 amino acids} combination allows any naive BALB/c mouse to have a large
pool of eligible LCMV-specific precursors in these three
subrepertoires. Therefore, the probability that some of
them will encounter the antigen during the infection is
very high, systematically leading to the three strong public
responses.
Horwitz et al. (21) reported three different TCR sequences used by T cell clones specific for the immunodominant NP118-126 epitope. Interestingly, one of these
clones expresses V
10 with a
chain CDR3 length of
nine amino acids, fitting one of the public responses we
observed in vivo. The two other clones characterized by
Horwitz et al. use the V
6 and V
7 segments that each
contribute 5-7% of the response in vivo (Fig. 4 B). It is
likely that the in vitro expansion and the substantial antigenic stimulation favored the isolation of these less frequent
LCMV-specific clones. Numerous studies have shown that
culturing lymphocytes in vitro may introduce drastic biases
in the composition of the resulting population (27).
Both our MHC-peptide tetramer-based flow cytometric
analysis and the direct quantitative reverse transcription
PCR analysis circumvent these in vitro biases (37, 38, 41,
44, 45).
Restricted T cell repertoires have been reported in other viral systems, including influenza (11, 19, 52), EBV (53- 55), HSV1 (22, 24, 56), CMV (12, 15), simian immunodeficiency virus (14), HIV (8), hepatitis C virus (13, 57), and enteric reovirus (23). Many of these viral infections elicit responses to several immunodominant epitopes; however, the TCR repertoire of each resulting response seems restricted. Limited TCR complexity in the CD8+ T cell pool seems to be a conserved feature of acute responses to viral infections. As reported here, this feature is also shared by LCMV; therefore, it is probable that antiviral T cell responses in general are governed by comparable rules and mechanisms.
The LCMV-specific Responses Leave Scars in the Immune T Cell Repertoire.Our analyses showed that LCMV NP118-
126-specific CD8+ T cells accounted for >10% of all
splenic CD8+ T cells in immune mice (Fig. 7 A). Here
again, the vast majority of these cells express V
10, V
8.1,
or V
8.2. This is corroborated by our kinetic analysis,
which shows an increase in V
10+CD8+ and V
8.1-8.2+
lymphocytes in the activated CD8 T cell population that
remains after viral clearance. These 2.1 × 105 NP118-126-specific V
10+CD8+ and 3.9 × 105 V
8.1-8.2+CD8+
T cells are large permanent "immunological scars" in the
TCR repertoire of the host, and reflect long-lasting NP118-
126-specific immunological memory (1). The systematic
occurrence of these scars makes them a tracer of past
LCMV infections in BALB/c mice. Studies performed both
in humans (58) and in mice (59) have shown that aged individuals accumulate expanded mono- or oligoclonal CD8+
and CD4+ T cell populations. Such oligoclonal populations
are especially seen among the CD8+ T cell subset. Our
study provides a possible explanation for this phenomenon.
Throughout the life of the individual, encounters with antigens leave long-lasting immunological scars. Systemic viral infections induce extensive CD8 T cell expansion in
vivo, and often this is due to extensive division of a limited
number of clones. The accumulation of such memory cell
populations with restricted TCR usage would thus shape
the T cell pools and result in highly biased TCR repertoires
in aged individuals, reflecting their immunological history.
Our study has shown that the TCR repertoire
of LCMV-specific memory cells in immune mice was similar to that of the acute primary response based on staining
with Ld-NP118-126 tetramers and V
antibodies. Also,
functional variant peptide analysis showed that the fingerprints of NP118-126-specific V
10+CD8+, V
8.1-8.2+
CD8+, or total CD8+ T cell were almost identical in the
primary response and in the memory pool, confirming that
the compositions of these LCMV-specific lymphocyte populations were conserved. Since the response was highly reproducible from mouse to mouse, these conclusions can be
made without longitudinal studies of individual mice over
time. It is well established that the majority of activated
CD8+ T cells undergo apoptosis, and only a small fraction
of these lymphocytes survive to become memory cells (1).
The selection processes that determine which T cells survive and which ones die are not fully understood. Our results show that this selection is not V
discriminant and
probably occurs stochastically in a TCR-independent manner.
The vast majority (>90%) of activated T cells die after the viral infection has been resolved, i.e., under conditions of limiting antigen. It has been proposed that T cells with high affinity TCR would get an antigenic stimulus and survive, whereas the low affinity T cells would be unable to compete for this limiting antigen and would die due to lack of appropriate signaling through the TCR (49, 60). A prediction of this model is that the TCR usage of memory T cells would be different (i.e., narrower) from the antigen-specific T cells activated during the primary response. Our results do not support this model, and show that TCR usage does not play a role in determining which activated CD8+ lymphocytes undergo apoptosis and which ones survive to become memory T cells.
Our refined
chain CDR3 length analysis showed that
the three dominant public responses (V
10, V
8.1, and
V
8.2) detected in primary infections and maintained in
the memory pool again expanded to comprise >70% of the
secondary response upon rechallenge with LCMV. Also,
the proportions of the minor NP118-126-specific CD8+ T
cell responses (V
7, V
13, V
6, etc.) were similar between primary and secondary effectors. In addition, the
functional fingerprints of secondary effector populations resembled that of the memory pool. This suggests that the
vast majority of the memory T cell pool was recruited to
clear these secondary infections. However, our analysis also
detected slight alterations in the secondary response to
LCMV. These were revealed by a stronger impact of inhibitory substitutions in the NP118-126 epitope on recognition by the V
10+ subset. The V
10+ response seemed
slightly more specific of the NP118-126 wild-type sequence, suggesting that this subrepertoire might have become somewhat focused upon rechallenge. Previous studies
have compared the TCR usage of primary and secondary T
cell responses in various systems. Although some studies on
CD8+ responses reported only limited changes (10, 32,
44), others found reduction of the TCR repertoire of
CD4+ (9, 61) or CD8+ (49) responses leading to focusing
of the antigen-specific T cell subset. One of these studies
reported a maturation of the CD8+ response to one of the
immunodominant epitopes in LCMV infection of C57BL/
6 mice (49). In that study, immune mice were challenged with a low dose of the LCMV WE strain, which would
lead to a much lower antigenic load than the highly invasive LCMV clone 13 strain we used. It is possible that the
extent of antigenic exposure during secondary response
plays a role in the recruitment of effectors from memory
cells. In our system, secondary responses had practically the
same magnitude as primary responses at their peak. The antigenic exposure was high, leading to a broad recruitment
of T cells and a TCR repertoire similar to that of the memory pool. However, if the antigenic load upon reexposure
is low, only a subset of memory T cells (high affinity/avidity ones) may participate in the secondary response. This
hypothesis (62) links the magnitude of the secondary response to the antigen dose and the minimal antigen sensitivity of the recruited T cells. We have shown that the
composition of the memory pool is similar to that of the
primary effector population. Therefore, we predict that,
more than the absolute size of the anamnestic response, it is
the ratio of its magnitude to that of the primary response
that determines the extent of recruitment among memory
T cells. If the sizes of the primary and secondary responses
are similar, it is likely that the TCR usage will be similar.
The memory T cell pool is a scar in the TCR repertoire of
the immune individual. Its composition is shaped both by
the antigen and the magnitude of the response to immunization. Therefore, it carries not only the memory of the
antigen but also the history of its encounter.
| |
Footnotes |
|---|
Address correspondence to Rafi Ahmed, Emory Vaccine Center, Rollins Research Center, Emory University, Atlanta, GA 30322. Phone: 404-727-3571; Fax: 404-727-3722; E-mail: ra{at}microbio.emory.edu
Received for publication 18 February 1998 and in revised form 9 April 1998.
C. Pannetier's current address is Laboratory of Immunology, National Institute of Allergies and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892.We thank Morry Hsu, Mary Kathryn Large, Kaja Madhavi Krishna, Joe Miller, and Tracey M. Waldem for technical assistance, and Suresh Marulasiddappa, Maryann Puglielli, and Rustom Antia for critical reading of the manuscript and stimulating discussions.
This work was supported by National Institutes of Health grants AI-30048 and NS-21496 (to R. Ahmed), by an American Cancer Society Institutional Research grant and the Winship Cancer Center of Emory University (to J.D. Altman). A.J. Zajac is supported by a fellowship from the Damon Runyon - Walter Winchell Foundation.
Abbreviations used in this paper C, constant; D, diversity; ELISPOT, enzyme-linked immunospot; J, joining; LCMV, lymphocytic choriomeningitis virus; LDA, limiting dilution assay; PCC, pigeon cytochrome C; V, variable.
| |
References |
|---|
|
|
|---|
| 1. | Ahmed, R., and D. Gray. 1996. Immunological memory and protective immunity: understanding their relation. Science 272: 54-60 [Abstract]. |
| 2. | Wilson, R.K., E. Lai, P. Concannon, R.K. Barth, and L.E. Hood. 1988. Structure, organization and polymorphism of murine and human T-cell receptor alpha and beta chain gene families. Immunol. Rev. 101: 149-172 [Medline]. |
| 3. | Davis, M.M.. 1990. T cell receptor gene diversity and selection. Annu. Rev. Biochem. 59: 475-496 [Medline]. |
| 4. | Goverman, J., K. Minard, N. Shastri, T. Hunkapiller, D. Hansburg, E. Sercarz, and L. Hood. 1985. Rearranged beta T cell receptor genes in a helper T cell clone specific for lysozyme: no correlation between V beta and MHC restriction. Cell. 40: 859-867 [Medline]. |
| 5. | Goverman, J., T. Hunkapiller, and L. Hood. 1986. A speculative view of the multicomponent nature of T cell antigen recognition. Cell 45: 475-484 [Medline]. |
| 6. | Davis, M.M., and P.J. Bjorkman. 1988. T-cell antigen receptor genes and T-cell recognition. Nature. 334: 395-402 [Medline]. |
| 7. | Garboczi, D.N., P. Ghosh, U. Utz, Q.R. Fan, W.E. Biddison, and D.C. Wiley. 1996. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature. 384: 134-141 [Medline]. |
| 8. | Pantaleo, G., J.F. Demarest, H. Soudeyns, C. Graziosi, F. Denis, J.W. Adelsberger, P. Borrow, M.S. Saag, G.M. Shaw, R.P. Sekaly, et al . 1994. Major expansion of CD8+ T cells with a predominant V beta usage during the primary immune response to HIV. Nature. 370: 463-467 [Medline]. |
| 9. |
McHeyzer-Williams, M.G., and
M.M. Davis.
1995.
Antigen-specific development of primary and memory T cells in vivo.
Science.
268:
106-111
|
| 10. | Maryanski, J.L., C.V. Jongeneel, P. Bucher, J.L. Casanova, and P.R. Walker. 1996. Single-cell PCR analysis of TCR repertoires selected by antigen in vivo: a high magnitude CD8 response is comprised of very few clones. Immunity. 4: 47-55 [Medline]. |
| 11. |
Moss, P.A.,
R.J. Moots,
W.M. Rosenberg,
J.S. Rowland,
H.C. Bodmer,
A.J. McMichael, and
J.I. Bell.
1991.
Extensive
conservation of alpha and beta chains of the human T-cell
antigen receptor recognizing HLA-A2 and influenza A matrix peptide.
Proc. Natl. Acad. Sci. USA.
88:
8987-8990
|
| 12. | Wills, M.R., A.J. Carmichael, K. Mynard, X. Jin, M.P. Weekes, B. Plachter, and J.G. Sissons. 1996. The human cytotoxic T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL. J. Virol. 70: 7569-7579 [Abstract]. |
| 13. | Kashii, Y., Y. Shimizu, S. Nambu, M. Minemura, K. Okada, K. Higuchi, and A. Watanabe. 1997. Analysis of T-cell receptor Vbeta repertoire in liver-infiltrating lymphocytes in chronic hepatitis C. J. Hepatol. 26: 462-470 [Medline]. |
| 14. |
Chen, Z.W.,
H. Yamamoto,
D.I. Watkins,
G. Levinson, and
N.L. Letvin.
1992.
Predominant use of a T-cell receptor V
beta gene family in simian immunodeficiency virus Gag-specific cytotoxic T lymphocytes in a rhesus monkey.
J. Virol.
66:
3913-3917
|
| 15. | Rodewald, H.R., U.H. Koszinowski, K. Eichmann, and I. Melchers. 1989. Predominant utilization of V beta 8+ T cell receptor genes in the H-2Ld-restricted cytotoxic T cell response against the immediate-early protein pp89 of the murine cytomegalovirus. J. Immunol. 143: 4238-4243 [Abstract] |