|
||
B-regulated X-chromosome-linked
iap Gene Expression Protects Endothelial Cells from Tumor
Necrosis Factor
-induced Apoptosis
By
From the Department of Vascular Biology and Thrombosis Research, Vienna International Research and Cooperation Center/University of Vienna, A-1235 Vienna, Austria
| |
Abstract |
|---|
|
|
|---|
By differential screening of tumor necrosis factor
(TNF-
) and lipopolysaccharide (LPS)-
activated endothelial cells (ECs), we have identified a cDNA clone that turned out to be a
member of the inhibitor of apoptosis (iap) gene family. iap genes function to protect cells from
undergoing apoptotic death in response to a variety of stimuli. These iap genes, hiap1, hiap2,
and xiap were found to be strongly upregulated upon treatment of ECs with the inflammatory
cytokines TNF-
, interleukin 1
, and LPS, reagents that lead to activation of the nuclear transcription factor
B (NF-
B). Indeed, overexpression of I
B
, an inhibitor of NF-
B, suppresses the induced expression of iap genes and sensitizes ECs to TNF-
-induced apoptosis.
Ectopic expression of one member of the human iap genes, human X-chromosome-linked iap
(xiap), using recombinant adenovirus overrules the I
B
effect and protects ECs from TNF-
-
induced apoptosis. We conclude that xiap represents one of the NF-
B-regulated genes that
counteracts the apoptotic signals caused by TNF-
and thereby prevents ECs from undergoing apoptosis during inflammation.
B
| |
Introduction |
|---|
|
|
|---|
Endothelial cells (ECs) are located at the strategic interface between blood stream and tissue and regulate local exchange of cells and nutrients. They are critically involved in local and systemic inflammatory responses at the sites of transmigration of immune cells such as neutrophils, monocytes, and lymphocytes. The concentration of inflammatory cytokines at the site of transmigration is expected to be high, and in fact inflammatory cytokine-mediated activation of ECs is responsible for the attraction, adhesion, and extravasation of white blood cells to the inflamed tissue.
Stimulation of cells with TNF-
, a potent inflammatory
cytokine, generates two types of signals: one that initiates
programmed cell death (1), and one that leads to activation
of the transcription factor NF-
B (2), and subsequently to
the inflammatory response. The overall result in a specific
cell type is dependent on the balance of the two signals.
Direct inhibition of NF-
B or of the upstream parts of its
signaling pathway during TNF-
activation results in apoptosis in a variety of cell types originally resistant to TNF-
-
induced apoptosis (3, 4). Furthermore, fibroblasts and macrophages from NF-
B subunit p65-deficient mice are
more sensitive to TNF-
-induced apoptosis (5). Therefore, it has been proposed that activation of NF-
B induces
the expression of genes that counteract apoptotic signals
and prevent cell death.
Members of the inhibitor of apoptosis (iap) gene family
have been demonstrated to suppress apoptosis induced by a
variety of stimuli in different cell types (6-13, and for review see reference 14). The iap genes have also been
shown to play a role in TNF-
-induced programmed cell
death. Different iap gene family members appear to interfere with the cell death-triggering cascade at different levels. hiap1 and hiap2 can bind to the TNFR-associated factor 2 (TRAF2), a molecule that is associated with the cytoplasmic part of the TNFR complex and is essential for the activation of NF-
B (9, 15). Both have also been shown to be
direct inhibitors of cell death proteases caspase 3 and
caspase 7 (16). Another iap gene family member, the
X-chromosome-linked iap (xiap), protects embryonic kidney 293T cells from bax-triggered apoptosis by inhibiting the same proteases, but in contrast it has not been found to
be associated with members of the TRAF family (16, 17).
The studies presented here demonstrate that three human iap gene family members (xiap, hiap1, and hiap2) are
strongly upregulated in TNF-
-stimulated primary ECs,
which are resistant to TNF-
-induced apoptosis. However, adenovirus-mediated overexpression of I
B
(18,
19), an inhibitor of NF-
B, renders primary ECs sensitive to TNF-
-induced apoptosis and at the same time inhibits
iap gene upregulation. Thus, iap gene expression appears to
be dependent on NF-
B activation. Importantly, we show
that ectopic expression of xiap is sufficient to overcome the
I
B
effect in I
B
-overexpressing ECs and protects these
cells from TNF-
-induced apoptosis.
| |
Materials and Methods |
|---|
|
|
|---|
Cell Culture
Cell culture flasks were coated with 1% gelatine for 30 min at 37°C. Human umbilical vein endothelial cells (HUVECs) and human skin microvascular endothelial cells (HSMECs) were grown in medium M199 supplemented with 20% bovine calf serum (HyClone, Logan, UT), endothelial cell growth factor supplement (Technoclone, Vienna, Austria), penicillin, streptomycin, fungizone, and heparin (3 U/ml). Confluent cells were split in a 1:3 ratio and used up to the sixth passage.
U937 cells were cultivated in RPMI-1640 medium supplemented with 10% FCS, L-glutamine, penicillin, and streptomycin. Cells were split 1:10 when grown to a density of 106 cells/ml.
Northern Analysis
Total RNA was isolated using Trizol reagent (GIBCO BRL,
Gaithersburg, MD). 10 µg total RNA was separated on a 1.3%
formaldehyde agarose gel. Samples were run in 0.02 M MOPS
(3-[N-morpholino]propanesulfonic acid), pH 7.0, 5 mM sodium acetate, 1 mM EDTA. The gel was blotted overnight using 10× SSC
onto a GeneScreen Plus nylon membrane (Dupont-NEN, Boston,
MA), dried, and fixed by UV-light (UV-cross-linker 120.000 µJ;
Stratagene Inc., La Jolla, CA). Membranes were hybridized with
-[32P]dATP-labeled (Terminal Transferase, Boehringer Mannheim,
Mannheim, Germany) oligonucleotides specific to hiap1 (5'-agaaatgtttcagtggcattcaatcaacccaaagatgtaatgtgtgactcatgaagcttct-3'), hiap2 (5'-aagatttccaccacaaaaagaaatcaatgatagactcttatgtagaatttactacactttc -3' ),
xiap (5'-gaagggtggtgggtgggaaacaacacagctccctaggaagagcacaggatagtcacggggg-3'), and naip (5'-actgcatctaggcccagaagagcagacagctctggcagcaaattgtgatcaaactgggaga-3') using Quickhyb-solution (Stratagene, Inc.)
at 65°C. Membranes were washed twice for 15 min at room temperature in 1% SDS/3× SSC/20 mM sodium phosphate buffer,
pH 7.2, and twice for 30 min at 65°C in 1% SDS/1× SSC. Signals were analyzed on a PhosphorImager SF (Molecular Dynamics, Sunnyvale, CA).
Adenovirus Construction and Infection
Adenovirus I
B
has been described previously (26), and construction of xiap adenovirus was done by firstly introducing a
fragment encoding the myc peptide sequence MEQKLISEEDL
into the adenovirus transfer vector pACCMVpLpASR+ (20).
Subsequently, a 1,600-bp BamHI/XbaI cDNA fragment containing the entire coding region of human xiap was ligated and the
construct was cotransfected together with pJM17, a plasmid containing the adenoviral genome with a deletion in the E1 region
into 293 cells (21). Plaques appearing after 10 d of culture were
subcloned on 293 cells and were tested for xiap expression on immunoblots using anti-myc mAb 9E10 (22). Purification of a large
batch of the recombinant adenovirus was done by two consecutive cesium chloride centrifugations as previously described (23).
Postconfluent HSMECs and HUVECs were washed once with complete PBS and incubated at a multiplicity of infection of 100 with the respective adenovirus constructs in PBS. After 30 min at 37°C, the adenovirus was washed off and fresh medium was added. Cells were maintained for an additional 2 d before being assayed.
Analysis of DNA Fragmentation
Electrophoresis of Genomic DNA.
Cells were incubated for 3 h at 55°C (100 mM NaCl, 10 mM Tris Hcl, pH 8.0, 25 mM EDTA, 0.5% SDS, 0.47 mg/ml Proteinase K), and then incubated with 100 µg/ml RNAseA for 1 h at 37°C. After phenol- chloroform extraction and isopropanol precipitation, the DNA was dissolved in 50 µl Tris/EDTA and resolved on 1.3% agarose gel.Quantification of Fragmented DNA.
For quantification of apoptosis fragmented DNA was determined by sandwich ELISA with antihistone coated microtiter plates and peroxidase-conjugated anti-DNA antibodies using the Cell Death Detection ELISA system from Boehringer Mannheim, according to the manufacturer's protocol.Flow Cytometry
48 h after infection cells were treated with TNF-
(500 U/ml)
for 6 h or left untreated. Cells were harvested, fixed in 70% ethanol, and the proportion of cells undergoing apoptosis was determined by flow cytometric analysis (FACSort®, Becton Dickinson, San Jose, CA) after staining with propidium iodide. Cells
with a DNA content <2 N appear in the sub-G1 region (M1).
| |
Results and Discussion |
|---|
|
|
|---|
Using a modified differential screening technique to
identify and clone genes regulated by inflammatory mediators in porcine aortic ECs (PAECs) (23a) we have obtained
a porcine homologue (piap) of the human iap gene family.
Initially identified as a TNF-
-inducible gene, piap was
found also to respond to the inflammatory stimuli LPS and
to a lesser degree to IL-1
. Subsequently, we have tested
whether members of the human iap gene family (xiap [hILP, MIHA], hiap1 [ciap2, MIHC], and hiap2 [ciap1,
MIHB]; references 6) show similar responses to inflammatory cytokines. Using oligonucleotides specific for the
different iap genes, we performed Northern blot analysis of
HSMECs (Fig. 1) and HUVECs (data not shown). We
demonstrate that, apart from the neuronal inhibitor of apoptosis (naip) that is not expressed in ECs, the xiap, hiap1, and
hiap2 genes were strongly upregulated in response to TNF-
in HSMECs and HUVECs.
|
Treatment of HSMECs or HUVECs with TNF-
for
up to 24 h did not lead to apoptosis, whereas the well-
established TNF-
-sensitive monocytic cell line U937 became apoptotic under these experimental conditions. iap
gene expression has been shown to inhibit apoptosis induced by a variety of apoptotic stimuli (12). Thus, we speculated that induced iap gene expression may prevent ECs
from undergoing programmed cell death in response to
TNF-
.
TNF-
is a proinflammatory cytokine whose pleiotropic
biological effects are signaled through two distinct cell surface receptors, TNFR 1 and TNFR 2 (2). It is known to
be a potent activator of NF-
B that has been shown to be
the central mediator of gene regulation in the inflammatory
response of activated ECs leading to leukocyte adhesion
and thrombosis (24, 25). Therefore, we tested whether
NF-
B was involved in upregulation of iap genes in response to inflammatory stimuli. Having shown previously
that expression of I
B
from a recombinant adenovirus
vector abolishes NF-
B-dependent upregulation of inflammatory genes such as IL-1
, IL-6, IL-8, and vascular cell
adhesion molecule 1 in LPS-stimulated ECs (26), we used
this adenovirus-I
B
construct to investigate whether
NF-
B inhibition also impairs iap gene expression. HUVECs and HSMECs were infected with either a control
adenovirus or the recombinant adenovirus I
B
(27). After
2 d, cells were stimulated with TNF-
for 4 h and probed for
xiap, hiap1, and hiap2 expression. As shown in Fig. 2, the
expression of all three iap genes tested in adenovirus I
B
-
infected ECs was suppressed, indicating that the upregulation of iap genes is controlled by activation of NF-
B.
|
We then raised the question whether blocking the activation of NF-
B would actually sensitize ECs to TNF-
-induced apoptosis. Indeed, ECs infected with the recombinant adenovirus I
B
construct started to die ~6 h
after TNF-
stimulation. To demonstrate that the apoptotic program is involved in cell death, genomic DNA was isolated from dying cells. As shown in Fig. 3, genomic
DNA from I
B
-expressing and TNF-
-treated cells, but
not from control virus-infected or nontreated cells, showed
the DNA fragmentation pattern characteristic for apoptosis.
Thus, inhibition of NF-
B activation renders ECs TNF-
sensitive, indicating that induction of apoptosis in ECs can
occur independent of NF-
B.
|
These data suggested that TNF-
-induced expression of
iap genes could be required to protect ECs from undergoing apoptosis. To directly demonstrate the ability of iap
genes to prevent ECs from TNF-
-induced apoptosis, we
coinfected HUVECs with recombinant adenovirus constructs expressing myc-tagged xiap and I
B
, respectively. Infection with recombinant adenovirus I
B
alone and
stimulation with TNF-
-induced apoptosis in HUVECs
(Fig. 4 B, c and d). Coexpression of xiap and I
B
(Fig. 4
B, f ) reduced the percentage of apoptotic cells to background levels obtained in TNF-
-treated or nontreated HUVECs (Fig. 4 B, a and b). A recombinant adenovirus
expressing green fluorescent protein (27) was used as a control to show that adenovirus infection itself had no influence on apoptosis induced by TNF-
in I
B
-overexpressing cells (Fig. 4 B, g and h). Expression of myc-tagged
xiap in infected HUVECs was demonstrated by Western
blots stained with anti-myc mAb (Fig. 4 A).
|
Since the monocytic cell line U937 is sensitive to TNF-
-induced apoptosis when compared to primary ECs, we
analyzed whether this cell line also differs with respect to
TNF-
-inducible upregulation of iap genes. U937 and
HUVECs were treated with TNF-
for 4, 6, and 9 h. At
the same time points we monitored and quantified apoptosis by analysis of fragmented genomic DNA using an
ELISA assay for histone-associated DNA fragments. Fig. 5
C shows that xiap gene was barely expressed in nontreated
U937 cells and expression could not be induced by TNF-
.
Consistently, U937 cells became significantly apoptotic after 4 h (Fig. 5 D). In contrast, as shown in Fig. 5, A and B,
xiap was upregulated in HUVECs and no increase in fragmented DNA could be assayed in response to TNF-
.
Identical results were obtained for hiap1 and hiap2 in U937
cells and HSMECs (data not shown).
|
Our findings provide several lines of evidence that the
iap gene products are regulated by NF-
B and that xiap appears to be sufficient to protect primary ECs from undergoing apoptosis in response to TNF-
: (a) iap genes are expressed in response to TNF-
, IL-1
, and LPS, respectively;
(b) inhibition of NF-
B activation suppresses inducible iap
gene expression; (c) inhibition of NF-
B activation by
overexpressing its inhibitor I
B
renders ECs sensitive to
TNF-
-induced apoptosis; and (d) ectopic expression of
xiap in I
B
-overexpressing ECs overrules the I
B
/
TNF-
effect.
These data show that ECs and presumably other cells
have developed cellular mechanisms that protect them
from apoptosis and keep them able to function properly in
an inflammatory situation. Fast activation of NF-
B in response to proinflammatory signals, like TNF-
, would be
an appropriate mechanism to ensure the prompt expression
of antiapoptotic gene(s). This hypothesis is supported by
the demonstration that NF-
B p65 is necessary to protect
fibroblasts from TNF-
-induced apoptosis (5).
Whether under physiological circumstances the expression of xiap is sufficient or whether simultanous expression
of all three iap genes (or other genes such as A20 [28], manganese superoxide dismutase [29], plasminogen activator-
inhibitor type 2 [30], A1 [31], or other as yet undefined
genes) is required to protect ECs from TNF-
-induced
apoptosis remains open. Chu et al. (32) have shown recently that hiap1 expression is dependent on activation of
NF-
B in Jurkat cells and hiap1 protein is able to protect these cells from apoptosis. However, in contrast to primary
ECs, hiap2 showed a steady state level of expression in Jurkat cells and was not controlled by NF-
B. The data indicate that expression of the iap gene family members and
their involvement in protection from apoptosis varies in
certain cell types and follows a rather complex scheme. iap
gene expression appears to be specific for the cell type and
the given stimulus. This view is supported by our finding
that iap gene expression seems to be not involved in the
TNF-
response of the monocytic cell line U937. These
cells become partially apoptotic upon TNF-
treatment
but do not express iap genes, suggesting that other protective mechanisms are operative. Recent reports demonstrated that hiap1/2 can interfere at different levels with the
apoptotic program. hiap1 and hiap2 associate via TRAF 2 with the TNFR 2, leading to NF-
B activation (9), and hiap2 is also part of the TNFR 1 signaling complex (15).
On the other hand, hiap1 and hiap2 as well as xiap directly
inhibit caspase 3 and caspase 7 activity, two members of the
caspase family of cell death proteases, in embryonic kidney
293T cells (16, 17). However, inhibition by xiap is two to
three orders of magnitude more potent, suggesting xiap as
the physiological inhibitor of caspase 3 and 7 (16). These
data and our finding that xiap expression is sufficient to
prevent TNF-
-induced apoptosis in ECs support the
concept that xiap plays a central role in inhibition of programmed cell death. It remains to be established whether
xiap operates via an identical mechanism in ECs as in 293T
cells and which other cell-type specific and stimulus-dependent mechanisms exist.
Unexpectedly, iap gene expression is also induced by
LPS and IL-1
. Pretreatment of a human fibrosarcoma line
(HT1080V) with the nonapoptotic, NF-
B-inducing IL-1
protects these cells from apoptosis induced by the later addition of TNF-
even in the presence of a protein synthesis
inhibitor (3). In cells expressing a super-repressor form of
the NF-
B inhibitor I
B
, IL-1
does not have this protective effect, suggesting that IL-1
also induces the expression of NF-
B-regulated antiapoptotic genes. A mechanism to overrule apoptotic signals during inflammation
would enable ECs to respond properly by upregulation of
inflammatory mediators such as tissue factor and adhesion
molecules and at the same time to survive inflammation in
order to maintain homeostasis of the inflamed tissue and
initiate the healing process.
| |
Footnotes |
|---|
Address correspondence to Joachim Lipp, Department of Vascular Biology and Thrombosis Research, VIRCC/University of Vienna, Brunnerstr. 59, A-1235 Vienna, Austria. Phone: 43-1-86634-565; Fax: 43-1-86634-623; E-mail: hans-joachim.lipp{at}univie.ac.at
Received for publication 8 December 1997 and in revised form 2 March 1998.
Ichiro Kumabashiri's current address is Department of Internal Medicine, Keiju General Hospital, Tomiokamachi 94, Nanao, Japan.We thank Drs. R. Kroismayr and T. Ebel for critical reading of the manuscript, and C. Kaun for providing HSMECs and HUVECs.
This work was supported by grants to J. Lipp from the Austrian Science Foundation, project SFB 005-05, and from the Jubilaeumsfonds of the Austrian National Bank, project 5548.
| |
References |
|---|
|
|
|---|
| 1. | Hale, A.J., C.A. Smith, L.C. Sutherland, V.E.A. Stoneman, V.L. Longthorne, A.C. Culhane, and G.T. Williams. 1996. Apoptosis: molecular regulation of cell death. Eur. J. Biochem. 236: 1-26 [Medline]. |
| 2. |
Barinaga, M..
1996.
Forging a path to cell death.
Science.
273:
735-737
|
| 3. |
Wang, C.Y.,
M.W. Mayo, and
A.S. Baldwin Jr..
1996.
TNF-
and cancer therapy-induced apoptosis: potentiation by inhibition of NF- B.
Science.
274:
784-787
|
| 4. |
Van Antwerpen, D.J.,
S.J. Martin,
T. Kafri,
D.R. Green, and
I.M. Verma.
1996.
Suppression of TNF- -induced apoptosis
by NF- B.
Science.
274:
787-789
|
| 5. |
Beg, A.A., and
D. Baltimore.
1996.
An essential role for
NF- B in preventing TNF- -induced cell death.
Science.
274:
782-784
|
| 6. |
Crook, N.E.,
R.J. Clem, and
L.K. Miller.
1993.
An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif.
J. Virol.
67:
2168-2174
|
| 7. |
Birnbaum, M.J.,
R.J. Clem, and
L.K. Miller.
1994.
An apoptosis inhibiting gene from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence motifs.
J. Virol.
68:
2521-2528
|
| 8. | Hay, B.A., D.A. Wassarman, and G.M. Rubin. 1995. Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death. Cell. 83: 1253-1262 [Medline]. |
| 9. | Rothe, M., M.G. Pan, W.J. Henzel, T.M. Ayres, and D.V. Goeddel. 1995. The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell. 83: 1243-1252 [Medline]. |
| 10. | Roy, N., M.S. Mahadevan, M. McLean, G. Shutler, Z. Yaraghi, R. Farahani, S. Baird, A. Besner-Johnston, C. Lefebvre, X. Kang, et al . 1995. The gene for neuronal apoptosis inhibitory protein is partially deleted in individuals with spinal muscular atrophy. Cell. 80: 167-178 [Medline]. |
| 11. | Duckett, C.S., V.E. Nava, R.W. Gedrich, R.J. Clem, J.L. Van Dongen, M.C. Gilfillan, H. Shiels, J.M. Hardwick, and C.B. Thompson. 1996. A conserved family of cellular genes related to the baculovirus iap gene and encoding apoptosis inhibitors. EMBO (Eur. Mol. Biol. Organ.) J. 15: 2685-2694 [Medline]. |
| 12. | Liston, P., N. Roy, K. Tamai, C. Lefebvre, S. Baird, G. Cherton-Horvat, R. Farahani, M. McLean, J.E. Ikeda, A. MacKenzie, and R.G. Korneluk. 1996. Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes. Nature. 379: 349-353 [Medline]. |
| 13. |
Uren, A.G.,
M. Pakusch,
C.J. Hawkins,
K.L. Puls, and
D.L. Vaux.
1996.
Cloning and expression of apoptosis inhibitory
protein homologs that function to inhibit apoptosis and/or
bind tumor necrosis factor receptor-associated factors.
Proc.
Natl. Acad. Sci. USA.
93:
4974-4978
|
| 14. | Clem, R.J., and C.S. Duckett. 1997. The iap genes: unique arbitrators of cell death. Trends Cell Biol. 7: 337-339 . [Medline] |
| 15. |
Shu, H.B.,
M. Takeuchi, and
D.V. Goeddel.
1996.
The tumor necrosis factor receptor 2 signal transducers TRAF2 and
c-IAP1 are components of the tumor necrosis factor receptor
1 signaling complex.
Proc. Natl. Acad. Sci. USA.
93:
13973-13978
|
| 16. | Roy, N., Q.L. Deveraux, R. Takahashi, G.S. Salvesen, and J.C. Reed. 1997. The c-IAP and c-IAP proteins are direct inhibitors of specific caspases. EMBO (Eur. Mol. Biol. Organ.) J. 16: 6914-6925 [Medline]. |
| 17. | Deveraux, Q.L., R. Takahashi, G.S. Salvesen, and J.C. Reed. 1997. X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388: 300-304 [Medline]. |
| 18. |
Baeuerle, P.A., and
D. Baltimore.
1996.
NF- B: ten years after.
Cell.
87:
13-20
[Medline].
|
| 19. |
Baldwin, A.S. Jr..
1996.
The NF- B and I B proteins: new
discoveries and insights.
Annu. Rev. Immunol.
14:
649-681
[Medline].
|
| 20. |
Gomex-Foix, A.M.,
W.S. Coats,
S. Baques,
T. Alam,
R.D. Gerard, and
C.B. Newgard.
1992.
Adenovirus-mediated
transfer of the muscle glycogen phosphorylase gene into
hepatocytes confers altered regulation of glycogen metabolism.
J. Biol. Chem.
267:
25129-25134
|
| 21. | McGrory, W.J., D.S. Bautista, and F.L. Graham. 1988. A simple technique for the rescue of early region I mutations into infectious human adenovirus type 5. Virology. 163: 614-617 [Medline]. |
| 22. |
Evan, G.I.,
K.G. Lewis,
G. Ramsay, and
M. Bishop.
1985.
Isolation of monoclonal antibodies specific for human c-myc
proto-oncogene product.
Mol. Cell Biol.
5:
3610-3616
|
| 23. | Graham, F.L., and A.J. Van der Eb. 1973. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology. 52: 456-467 [Medline]. |
| 23a. |
Stehlik, C.,
M. de Martin,
B.R. Binder, and
J. Lipp.
1998.
Cytokine induced expression of porcine inhibitor of apoptosis
protein (iap) family member is regulated by NF- B.
Biochem.
Biophys. Res. Commun.
243:
827-832
[Medline].
|
| 24. |
Collins, T..
1993.
Biology of disease: endothelial nuclear factor- B and the initiation of the atherosclerotic lesion.
Lab.
Invest.
68:
499-508
[Medline].
|
| 25. |
Collins, T.,
M.A. Read,
A.S. Neish,
M.Z. Whitley,
D. Thanos, and
T. Maniatis.
1995.
.Transcriptional regulation of endothelial
cell adhesion molecules: NF- B and cytokine-inducible enhancers.
FASEB (Fed. Am. Soc. Exp. Biol.) J.
9:
899-909
[Abstract].
|
| 26. |
Wrighton, C.J.,
R. Hofer-Warbinek,
T. Moll,
R. Eytner,
F.H. Bach, and
R. de Martin.
1996.
Inhibition of endothelial
cell activation by adenovirus-mediated expression of I B ,
an inhibitor of the transcription factor NF- B.
J. Exp. Med.
183:
1013-1022
|
| 27. | de Martin, R., M. Raidl, E. Hofer, and B.R. Binder. 1997. Adenovirus-mediated expression of green fluorescent protein. Gene Ther. 4: 493-495 [Medline]. |
| 28. |
Opipari, A.W. Jr,
H.M. Hu,
R. Yabkowitz, and
V.M. Dixit.
1992.
The A20 zinc finger protein protects cells from tumor
necrosis factor cytotoxicity.
J. Biol. Chem.
267:
12424-12427
|
| 29. | Wong, G.H.W., J.H. Elwell, L.W. Oberley, and D.V. Goeddel. 1989. Manganous superoxide dismutase is essential for cellular resistance to cytotoxicity of tumor necrosis factor. Cell. 58: 923-931 [Medline]. |
| 30. |
Kumar, S., and
C. Baglioni.
1991.
Protection from tumor necrosis factor-mediated cytolysis by overexpression of plasminogen activator inhibitor type-2.
J. Biol. Chem.
266:
20960-20964
|
| 31. |
Karsan, A.,
E. Yee,
K. Kaushansky, and
J.M. Harlan.
1996.
Cloning of a human bcl-2 homologue: inflammatory cytokines induce human A1 in cultured endothelial cells.
Blood.
87:
3089-3096
|
| 32. |
Chu, Z.L.,
T.A. McKinsey,
L. Liu,
J.J. Gentry,
M.H. Malim, and
D.W. Ballard.
1997.
Suppression of tumor necrosis factor-
induced cell death by inhibitor of apoptosis c-iap2 is under
NF- B control.
Proc. Natl. Acad. Sci. USA.
94:
10057-10062
|
This article has been cited by other articles: