|
||
By
§
§
From the * Harvard Medical School, Division of Viral Pathogenesis, Department of Medicine, Beth
Israel Deaconess Medical Center, Boston, Massachusetts 02215;
Wisconsin Regional Primate
Research Center and § Department of Pathology and Laboratory Medicine, University of Wisconsin,
Madison, Wisconsin 53715;
Eppimune, San Diego, California 92121; and the ¶ Coulter
Corporation, Miami, Florida 33116
| |
Abstract |
|---|
|
|
|---|
A tetrameric recombinant major histocompatibility complex (MHC) class I-peptide complex
was used as a staining reagent in flow cytometric analyses to quantitate and define the phenotype of Gag-specific cytotoxic T lymphocytes (CTLs) in the peripheral blood of simian immunodeficiency virus macaque (SIVmac)-infected rhesus monkeys. The heavy chain of the rhesus
monkey MHC class I molecule Mamu-A*01 and
2-microglobulin were refolded in the presence of an SIVmac Gag synthetic peptide (p11C, C-M) representing the optimal nine-amino
acid peptide of Mamu-A*01-restricted predominant CTL epitope to create a tetrameric
Mamu-A*01/p11C, C-M complex. Tetrameric Mamu-A*01/p11C, C-M complex bound to
T cells of SIVmac-infected, Mamu-A*01+, but not uninfected, Mamu-A*01+, or infected,
Mamu-A*01
rhesus monkeys. Specific staining of peripheral blood mononuclear cells
(PBMC) from SIVmac-infected, Mamu-A*01+ rhesus monkeys was only found in the cluster
of differentiation (CD)8
/
+ T lymphocyte subset and the percentage of CD8
/
+ T cells in
the peripheral blood of four SIVmac-infected, Mamu-A*01+ rhesus monkeys staining with this
complex ranged from 0.7 to 10.3%. Importantly, functional SIVmac Gag p11C-specific CTL
activity was seen in sorted and expanded tetrameric Mamu-A*01/p11C, C-M complex-binding, but not nonbinding, CD8
/
+ T cells. Furthermore, the percentage of CD8
/
+ T cells
binding this tetrameric Mamu-A*01/p11C, C-M complex correlated well with p11C-specific
cytotoxic activity as measured in both bulk and limiting dilution effector frequency assays. Finally, phenotypic characterization of the cells binding this tetrameric complex indicated that
this lymphocyte population is heterogeneous. These studies indicate the power of this approach
for examining virus-specific CTLs in in vivo settings.
| |
Introduction |
|---|
|
|
|---|
Cytotoxic T lymphocytes (CTLs) play an important role in containing virus spread in many viral infections. However, the activity of this cell population in vivo has proven difficult to study because its evaluation has relied on cumbersome, functional assays that require extensive cell manipulation and lengthy in vitro periods of cell cultivation. Altman et al. have recently reported that fluorescence dye-coupled tetrameric MHC class I-peptide complexes can specifically bind to subpopulations of epitope-specific cluster of differentiation (CD)18+ T cells, raising the possibility that CTLs might be studied using flow cytometric technology (1).
There is accumulating evidence for the importance of CTLs in controlling HIV-1 and simian immunodeficiency virus replication in both primary and chronic infections (2- 6). We have been studying the role of this cellular immune response in AIDS immunopathogenesis in the simian immunodeficiency virus (SIV)/macaque model of AIDS. Much of this work has focused on the evaluation of SIVmac Gag recognition by CTL in rhesus monkeys expressing the HLA-A homologue molecule Mamu-A*01. In fact, we have shown that CTL recognition of Gag in SIVmac-infected or vaccinated Mamu-A*01+ rhesus monkeys is restricted to a single epitope, 12-amino acid fragment of SIVmac 251 Gag (amino acid 179-190) (p11C), bound to Mamu-A*01 (7). Through studying the monkeys' response to this dominant CTL epitope, we have been able to evaluate efficiently a variety of novel vaccine strategies for eliciting SIVmac-specific CTL responses and assess the role of CTLs in containing the replication of SIVmac during primary and chronic infections (8).
In these studies, we have generated tetrameric Mamu-A*01/p11C, C-M complex using the optimal nine-amino acid fragment of SIVmac (amino acids 181-189) p11C, C-M (12) and evaluated its binding specificity in PBMCs of SIVmac-infected, Mamu-A*01+ rhesus monkeys. We demonstrate that the enumeration of CD8+ T cells that bind this complex in flow cytometric analyses correlates quantitatively with functional CTL activity and that this cell population is phenotypically heterogeneous.
| |
Materials and Methods |
|---|
|
|
|---|
Tetrameric Mamu-A*01/p11C, C-M Complex Formation.
DNA coding for the soluble domain of Mamu-A*01 with a GlySer linker at the 3' end was amplified by PCR with the 5' primer GTCACTGAATTCAGGAGGAATTTAAAATGGGCTCTCACTC-CATGAAG and the 3' primer CGCACTGGATCCCGGCTCCCATTTCAGGGTGTGGGGC, using a Mamu-A*01 plasmid as the template (7). The PCR product was digested with EcoRI and BamHI, and subcloned into the expression plasmid HLA-A2/GlySer/BSP (BSP, BirA substrate peptide; reference 1), which contains the BSP (13) at the 3' end. The expressed protein was refolded in vitro with human
2-microglobulin (
2m) in the
presence of a specific peptide as described (14). The optimal
nine-amino acid fragment of SIVmac 251 Gag (amino acids 181-
189; p11C, C-M) CTPYDINQM (12) was used to induce refolding of the MHC class I molecule. The Mamu-A*01/p11C, C-M
monomers were purified by gel filtration on a TSK SWxl 3,000 column (TosoHaas, Montgomeryville, PA; Fig. 1 A), and further
purified on a MonoQ column (Pharmacia, Piscataway, NJ) in 20 mM Tris (pH 8.0) with a gradient of NaCl from 0 to 0.5 M. The
monomer was then stored in PBS with protease inhibitors: 2 µM
PMSF (Sigma Chemical Co., St. Louis, MO), 1 mM dithiothreitol
(Sigma Chemical Co.), 1 µg/ml aprotinin (Sigma Chemical Co.),
0.7 mg/ml pepstatin A (Sigma Chemical Co.), 1 µg/ml leupeptine (Sigma Chemical Co.), and 1 µM EDTA (Sigma Chemical Co.). The 43-kD peak from the gel filtration (Fig. 1 A) was immunoprecipitated with the anti-human MHC class I heavy
chain-specific mAb BB7.7 (American Type Culture Collection,
Rockville, MD) and run on a 15% reducing SDS/PAGE (Fig. 1
B). Purified Mamu-A*01/p11C, C-M monomers were biotinylated enzymatically with BirA enzyme (Avidity, Denver, CO),
following the manufacturer's instructions. The efficiency of biotinylation was between 75 and 95%. A TSK SWxl 3,000 column was used to remove the free biotin from the monomers (Fig. 1
C). To generate the Mamu-A*01/p11C, C-M tetramers, the biotinylated monomers were mixed with FITC-labeled ExtrAvidin
(Sigma Chemical Co.) at a molar ratio of 4:1 and were purified
by gel filtration on a TSK SWxl 3,000 column (Fig. 1 D).
|
Animals.
Heparinized blood samples were obtained from rhesus monkeys (Macaca mulatta) experimentally infected with uncloned SIVmac strain 251 and healthy uninfected rhesus monkeys. These animals were maintained in accordance with the guidelines of the Committee on Animals for the Harvard Medical School (Cambridge, MA) and the "Guide for the Care and Use of Laboratory Animals" (Department of Health and Human Services Publication, National Institutes of Health, No. 82-23, revised 1985).Selection of Mamu-A*01+ Rhesus Monkeys.
The selection of the Mamu-A*01+ rhesus monkeys was carried out by using monkey B lymphoblastoid cell lines (B-LCLs) for one-dimensional isoelectric focusing (1-D IEF; reference 15) and functional CTL assays. In brief, the monkey B-LCLs were generated by transforming PBMCs with Herpesvirus papio (16). Cells were 35S-trans-labeled for 6 h at 37°C. Pelleted cells were lysed on ice in lysis buffer, and lysates were precleared by incubating with protein A-Sepharose CL-4B beads (Sigma Chemical Co.) alone and with beads saturated with irrelevant antibodies. Immunoprecipitation was performed by incubating the precleared lysates with protein A-Sepharose CL-4B beads saturated with the mAb BB7.7. The beads were washed and then treated with neuraminidase type VIII (Sigma Chemical Co.). BB7.7 immunoprecipitates were analyzed by 1-D IEF as described previously (15). The MHC class I haplotypes of the B-LCLs selected as Mamu-A*01+ by 1-D IEF were confirmed by conventional CTL assays. The selected B-LCL, following pulsing with the peptide p11C, were assessed for susceptibility to lysis by in vitro cultured effector cells from SIVmac-infected, Mamu-A*01+ rhesus monkeys. Those animals expressing a shared band detected by 1-D IEF and whose B-LCLs were specifically lysed by effector cells from SIVmac-infected, Mamu-A*01+ monkeys were noted to be Mamu-A*01+.Cytotoxicity Assay.
Autologous B-LCLs were used as target cells in functional CTL assays. B-LCLs were incubated with 50 µg/ml p11C (EGCTPYDINQML) or the negative control peptide p11B (ALSEGCTPYDIN) for 90 min during 51Cr labeling. For effector cells, PBMCs from monkeys chronically infected with SIVmac were cultured for 3 d at 106 cells/ml with Con A (5 µg/ml; Sigma Chemical Co.), washed, and then maintained for another 7 to 11 d in medium supplemented with recombinant human IL-2 (20 U/ml; provided by Hoffman-La Roche, Nutley, NJ). Alternatively, PBMCs were mixed with p11C-pulsed irradiated autologous PBMCs at a ratio of 1:1 and cultured for 3 d at a density of 106 cells/ml. Cells were then maintained for another 7 to 11 d in medium supplemented with recombinant human IL-2 (20 U/ml) as described above. PBMCs cultured according to one of these two protocols were then centrifuged over Ficoll-Hypaque (Ficopaque; Pharmacia) and assessed as effector cells in a standard 51Cr-release assay using U-bottomed microtiter plates containing 104 target cells with effector cells at different E/T ratios. All wells were established and assayed in duplicate. Plates were incubated in a humidified incubator at 37°C for 4 h. Specific release was calculated as [(experimental release
spontaneous release)/(maximum release
spontaneous release)] × 100. Spontaneous release
was <20% of maximal release with detergent (1% Triton X-100;
Sigma Chemical Co.) in all assays.
Limiting Dilution Assays.
Freshly isolated PBMCs from monkeys chronically infected with SIVmac were cultured at 63-8,000 cells/well in 24 replicate wells of 96-well microtiter plates. 10,000 gamma-irradiated autologous PBMCs, which had been previously pulsed with p11C for 1 h and washed two times, were added to each well. These cultures were then maintained in 100 µl of medium supplemented with the T cell growth factor Lymphocult T (Biotest AG, Dreieich, Germany) at 10 U/ml at 37°C for 14 d. Microcultures were fed at 5 and 10 d by the addition of 50 µl medium supplemented with 10 U/ml Lymphocult T. Lymphocytes from each well were tested for cytotoxicity against autologous B-LCLs labeled with peptide p11C or the control peptide p11B. Supernatants were harvested and counted for radioactivity after a 4-h incubation at 37°C. The fraction of nonresponding wells was the percentage of wells in which 51Cr-release did not exceed the mean plus three standard deviations of the spontaneous release of the 24 control wells. The specific precursor frequency of CTLs (pCTL) was estimated by the maximum likelihood method by substraction of background values of control peptide-labeled B-LCLs (17).Staining and Phenotypic Analysis of p11C-specific CD8+ T Cells.
The mAbs used for this study were directly coupled to PE, PE-Texas red (ECD), or allophycocyanin (APC). The following mAbs were used: anti-CD8
(OKT8)-PE (Dako Corp.,
Carpinteria, CA), anti-CD11a(25.3.1)-PE, anti-CD14(MY4)-PE,
anti-CD28(4B10)-PE, anti-CD45RA(2H4)-PE, anti-HLA-DR(I3)- PE, and anti-CD8
/
(2ST8-5H7)-ECD (Coulter Corp., Miami,
FL). The mAb FN18 (gift from D.M. Neville, Jr., National Institutes of Health, Bethesda, MD), which recognizes rhesus monkey
CD3, was directly coupled to APC. The three reagents: FITC-coupled tetrameric Mamu-A*01/p11C, C-M complex, anti-CD8
/
-ECD, and anti-rhesus monkey CD3-APC were used either
with anti-CD8
-PE, anti-CD11a-PE, anti-CD28-PE, anti-CD45RA-PE, or anti-HLA-DR-PE to perform four-color flow
cytometric analyses. 1 µg of FITC-coupled tetrameric Mamu-A*01/p11C, C-M complex was used in conjunction with the directly labeled mAbs to stain either 100 µl of fresh whole blood or
2 × 105 lymphocytes isolated by density gradient centrifugation
over Ficoll-Hypaque after in vitro culture. Whole blood samples
were lysed using a COULTER® Immunoprep Reagent System
and a Q-Prep Workstation (Coulter Corp.). To reduce the background level of staining, the Q-Prep procedure was modified,
and lysed samples were washed with 1.0 ml PBS and centrifuged
for 3 min at 300 g. Similarly, the stained lymphocyte samples
were washed with 1.0 ml PBS and centrifuged for 3 min at 300 g.
The supernatants were decanted, cells were resuspended in 0.5 ml
PBS containing 1% paraformaldehyde, and then were maintained for 24 h at 4°C before flow cytometric analysis. Samples were analyzed on a COULTER® EPICS® Elite ESP (Coulter Corp.)
equipped with argon and helium neon lasers, a gated amplifier,
and a 140-µm flow cell tip. The instrument was run at high
bandwidth and alignment was controlled on a daily basis using
DNA-CHECK EPICS® Alignment Fluorospheres (Coulter
Corp.) to maintain the same sensitivity levels during the entire
study. Linear performance in each channel was controlled using
the EPICS® Immuno-Brite Standards Kit (Coulter Corp.). Voltage and compensation levels were established using control samples of unstained cells for adjusting the negative/background levels of fluorescence to the first log step and single-color stained
cells for adjusting spectral overlap. For analysis of whole blood
specimens, a single set of control samples was prepared from
whole blood of one animal on a daily basis. For analysis of in vitro
cultured cells, control samples were prepared from Ficoll-Hypaque
isolated lymphocytes of each culture. A total of 10,000 to 20,000 lymphocytes were analyzed in a manually set acquisition gate and
positive cutoffs for fluorescence were set to the first log step to include <0.1% of nonstaining cells. Data analysis was performed
using the EPICS® Elite software (version 4.02; Coulter Corp.).
Data presentation was performed using WinMDI software version 2.5 (Joseph Trotter, La Jolla, CA) and Microsoft PowerPoint
software version 4.0c (Microsoft Corp., Redmond, WA).
Sorting and Culture of CD8
/
+ T Cell Subsets from PBMCs of
SIVmac-infected Rhesus Monkeys.
/
-ECD, and anti-rhesus monkey
CD3-APC for 20 min on ice. The cells were then washed twice
with PBS supplemented with 10% FCS and maintained on ice
until sorting. FITC-coupled tetrameric Mamu-A*01/p11C, C-M
complex positive and negative CD8
/
+ T cells, and CD14+
monocytes were electronically gated and collected in sample
tubes cooled to 4°C. The sorted cells were centrifuged at 300 g
for 10 min and the pellets were resuspended in RPMI 1640 containing 10% FCS, 5 µg/ml Con A, and 20 U/ml IL-2. Equal
numbers of CD14+ monocytes were cultured for 10 d either with
FITC-coupled tetrameric Mamu-A*01/p11C, C-M complex
positive or negative CD8
/
+ T cells. The p11C-specific staining of the CD8
/
+ T cells was investigated by flow cytometric
analysis and the cytotoxic activity was evaluated by performing a
standard 51Cr-release assay as described above.
| |
Results |
|---|
|
|
|---|
/
+ Subset of T Cells from SIVmac-infected, Mamu-A*01+ Rhesus Monkeys.
We initially sought to characterize the binding specificity of the tetrameric Mamu-A*01/
p11C, C-M complex. Since the TCRs of CD8+ CTLs
recognize self-MHC class I-peptide complexes, we expected the tetrameric Mamu-A*01/p11C, C-M to bind
specifically to a subpopulation of CD8+ T cells from SIVmac-infected, Mamu-A*01+ rhesus monkeys, but not to
CD8+ T cells from uninfected, Mamu-A*01+ or SIVmac-infected, Mamu-A*01
monkeys. PBMCs from three groups
of rhesus monkeys (three monkeys per group) were assessed: SIVmac
Mamu-A*01+, SIVmac+ Mamu-A*01
,
and SIVmac+ Mamu-A*01+. Whole blood specimens from
these monkeys were analyzed by flow cytometry with
four-color staining using FITC-coupled tetrameric Mamu-A*01/p11C, C-M complex to quantitate the percentage of
p11C-specific CD8+ T cells. The mAbs used in this study
included anti-CD3, anti-CD8
, and anti-CD8
/
. Because of Fc receptor expression by B cells and monocytes,
we expected some nonspecific binding of the tetramer complexes to these cell populations. However, we expected binding of tetramer complexes to T cells only in infected animals expressing the appropriate MHC class I molecule. The CD8 molecule is expressed on T cells either as a
CD8
/
homodimer or a CD8
/
heterodimer (18).
Natural killer cells express the CD8 molecule only as an
/
homodimer. Since T cells expressing the CD8
/
homodimer do not necessarily interact in an MHC class I-restricted
fashion (23), we expected a higher binding of the tetramer
complex to CD8
/
+ T cells than to CD8
/
+ T cells.
We noticed some nonspecific binding of the Mamu-A*01/p11C, C-M complex to a subset of B cells and
monocytes in all the animals studied (data not shown). Although the T cells expressing CD8
/
but not CD8
/
in the peripheral blood of the monkeys represented in occasional animals up to 40% of the total CD8+ T cells (data
not shown), almost all (>95%) Mamu-A*01/p11C, C-M complex-binding T cells expressed the CD8
/
heterodimer (Fig. 2). Therefore, in evaluating Mamu-A*01/
p11C, C-M complex-binding cells by flow cytometry,
CD8
/
+ T cells were gated and expression of the CD3
molecule was determined as an internal control.
|
Tetrameric Mamu-A*01/p11C, C-M complex-binding
CD8
/
+ T cells were detected only in PBMCs of SIVmac-infected, Mamu-A*01+ rhesus monkeys. The percentage of the positive cells ranged from 0.9 to 10.3% of
CD8
/
+ T cells (Fig. 3). Relatively small changes in the
percentage of tetrameric Mamu-A*01/p11C, C-M complex-binding CD8
/
+ T cells were observed performing
repeated analyses on blood of individual monkeys over a
period of 8 mo (data not shown). No detectable staining
was seen of the CD8
/
+ T cells in PBMCs of the other
two groups of animals, indicating that the Mamu-A*01/
p11C, C-M complexes bound specifically to CD8
/
+ T
cells of SIVmac-infected, Mamu-A*01+ rhesus monkeys.
|
/
+ T Cells are p11C-specific CTLs.
To characterize the function and specificity of the Mamu-A*01/p11C,
C-M complex-binding cells, CD8
/
+ T cells of a SIVmac-infected, Mamu-A*01+ rhesus monkey were sorted
by flow cytometry into cell populations that stained positively or negatively with the Mamu-A*01/p11C, C-M tetramer complex. Both cell populations were then expanded after Con A stimulation in IL-2-containing medium for 10 d,
analyzed again by flow cytometry for Mamu-A*01/p11C,
C-M tetramer complex binding, and assayed for p11C-specific CTL activity. Greater than 90% of the sorted tetrameric Mamu-A*01/p11C, C-M complex positive cells
still bound this complex after in vitro expansion. These cells showed a high p11C-specific CTL activity, even at
very low effector to target ratios (>20% specific lysis at a
0.16:1 E/T ratio; Fig. 4). On the other hand, the CD8
/
+ T cells that initially did not bind remained tetrameric
Mamu-A*01/p11C, C-M complex negative and had no
p11C-specific CTL activity (Fig. 4). Thus, all expanded
CD8
/
+ T cells with the potential to mediate p11C-specific lysis bound the tetrameric Mamu-A*01/p11C, C-M
complex.
|
Standard
methods for analyzing and quantifying antigen-specific
CTL activity involve functional assays performed on lymphocytes expanded in vitro after nonspecific or antigen-specific stimulation. We sought to determine whether the
enumeration of tetrameric Mamu-A*01/p11C, C-M complex-binding cells in PBMCs correlated quantitatively with functional CTL activity measured using standard functional
assays. To this end we first compared tetrameric Mamu-A*01/p11C, C-M complex staining of CD8
/
+ T cells
of an SIVmac-infected, Mamu-A*01+ monkey before and
after in vitro expansion of PBMCs. A representative experiment is shown in Fig. 5. CD8
/
+ T cells that bound this
complex increased from 10.3 to 22.4% after 12 d of culture
after nonspecific stimulation and showed p11C-specific
CTL activity of 73% lysis at an E/T ratio of 80:1 (Fig. 5,
top right). In vitro expansion after antigen-specific stimulation with p11C-pulsed autologous PBMCs resulted in an
increase of cells binding this complex from 10.3 to 86.3%.
p11C-specific CTL activity of 74% lysis was detected using
these lymphocytes as effector cells at an E/T ratio of 10:1
(Fig. 5, bottom right). Similar experiments were performed
using PBMCs from three other SIVmac-infected, Mamu-A*01+, rhesus monkeys (Table 1).
|
|
A limiting dilution assay (LDA) is currently accepted as
the most precise method available for quantifying the precursor frequency of CTLs in PBMCs. In parallel with the
studies described above, we performed LDAs on PBMCs
of these four infected monkeys (Table 1). In fact, the rank
ordering of the tetrameric Mamu-A*01/p11C, C-M complex staining of CD8
/
+ T cells of these monkeys was
in accordance with the quantification of p11C-specific
CTLs seen in both bulk and LDA functional assays. These
findings suggest that the cell staining with the tetrameric complex should provide useful quantitative data in CTL
analyses.
/
+ T Cells in PBMCs of SIVmac-infected, Mamu-A*01+ Rhesus Monkeys Are Phenotypically Heterogeneous.
The phenotype of CD8
/
+ tetramer-binding cells of
SIVmac-infected, Mamu-A*01+ rhesus monkeys was investigated by four-color flow cytometric analysis. CD8
/
+ T cells were evaluated for binding of the tetrameric
Mamu-A*01/p11C, C-M complex and expression of CD11a,
CD28, CD45RA, and MHC class II DR. The tetrameric
complex-binding CD8
/
+ T cells in the peripheral
blood of all four animals showed a relatively high mean fluorescence in anti-CD11a staining (representative staining
for CD11a is shown in Fig. 6 A) and were predominantly CD45RA
(Table 2 and Fig. 6 B). (No anti-CD45RO
mAb is available that binds to rhesus monkey CD45RO.)
Interestingly, a heterogeneous expression of the CD28
molecule was observed investigating tetrameric complex-
binding CD8
/
+ T cells in this group of four rhesus
monkeys; these cells from two animals were predominantly
CD28+ and from another animal predominantly CD28
(Table 2 and Fig. 6 C). This skewing in CD28 expression
on tetrameric complex-binding cells did not correlate with
CD28 expression on the nonbinding CD8
/
+ T cells.
MHC class II DR expression was higher on tetrameric complex binding cells from three of the four rhesus monkeys compared to their nonreactive CD8
/
+ T cells,
with
50% of these cells expressing the MHC class II DR
molecule (Table 2 and Fig. 6 D).
|
|
| |
Discussion |
|---|
|
|
|---|
The use of a tetrameric MHC class I-peptide complex
was evaluated as a staining reagent for flow cytometric
analysis of a virus epitope-specific CTL response in SIVmac-infected rhesus monkeys. We found that this complex
bound specifically to a subset of CD8
/
+ T cells from infected monkeys of the appropriate MHC class I haplotype.
Moreover, the percentage of CD8
/
+ T cells binding
this complex correlated well with epitope-specific functional cytotoxic activity as measured in both bulk and limiting dilution assays.
Significantly different estimates of HIV- and SIV-specific CTL precursor cell numbers have been generated using different techniques. Functional limiting dilution analysis, a standard method for quantitating CTLs, has revealed a frequency of HIV-1-specific pCTLs between 0.001 and 0.1% of PBMCs in infected individuals (24). Higher levels of pCTLs, ranging from 0.2 to 1% of T cells, have been estimated when TCR complementarity determining region 3 (CDR3) sequences were used as molecular markers for individual CTL clones to estimate the frequency of these cells in PBMCs (27). Staining with tetrameric MHC class I-peptide complexes for evaluation of HIV-1 Gag- and Pol-specific CTLs has provided estimates of a similar order of magnitude (1).
In this study we estimated pCTLs in the same lymphocyte population of SIVmac-infected rhesus monkeys using
both functional LDAs and tetramer staining technologies.
We also found a significant discrepancy in this rhesus monkey animal model when comparing the results obtained by
standard LDA and tetrameric Mamu-A*01/p11C, C-M
complex staining. The p11C-specific pCTLs as determined
by tetrameric Mamu-A*01/p11C, C-M complex staining
PBMCs of the four SIVmac-infected, Mamu-A*01+ rhesus
monkeys ranged between 0.7 and 10.3% of CD8
/
+ T
cells, whereas the highest pCTL estimate arrived at by
LDAs was 0.02% of all PBMCs, which is equivalent to
0.1% of CD8
/
+ T cells. A number of factors may be
contributing to the substantial discrepancy between these
estimates. Different culture conditions used in LDAs can
generate very different precursor frequency estimates. Thus,
whether an anti-CD3 antibody is used to stimulate cells, whether cells are cultured in the presence of a crude T cell
growth factor, or whether the antigen used in the assay is
an actively synthesized viral protein or a synthetic peptide
can have a substantial impact on the estimated pCTLs. It is
also possible that a cell population that can bind a single
peptide-MHC class I complex is functionally heterogeneous, with only a fraction of the cells being capable of lysing virus-infected target cells at any point in time.
In fact, the phenotypic characterization of the tetrameric
Mamu-A*01/p11C, C-M complex-binding cells suggests
that these cells are heterogeneous in individual monkeys.
Most of the Mamu-A*01/p11C, C-M-binding cells in
these studies expressed relatively high levels of CD11a and
did not express CD45RA, suggesting that they were memory rather than naive lymphocytes. This observation is in
agreement with Altman et al. who described a homogeneous phenotypic memory type profile (CD45RO+ and
CD62L
) for their MHC class I-peptide binding cells (1).
Previous studies have suggested that HIV-1-specific CTLs
are HLA-DR+ and CD28
(28). However, we found a
heterogeneous expression of CD28 and MHC class II DR
by the tetrameric complex-binding T cells. Heterogeneity
in expression of these molecules by the Mamu-A*01/ p11C, C-M-binding cells is consistent with the possibility
of heterogeneity in their function.
The percentage of circulating CD8
/
+ T cells that
bound the tetrameric Mamu-A*01/p11C, C-M complex
was remarkably constant over a period of months in three
of the four chronically SIVmac-infected rhesus monkeys
that we have studied. In the fourth animal, rhesus monkey
403, the percentage was much higher than in others, varying between 4.6 and 10.3%. However, there was considerable variability between the different animals in the percentage of CD8
/
+ peripheral blood T cells binding this
complex. A number of factors may lead to this variability.
A particularly high level of persistent antigenemia may
contribute to a persistent clonal expansion of CD8
/
+ virus-specific CTLs. In light of the recent demonstration that vigorous CTL responses correlate with low virus load in
HIV-1-infected humans (33), this is an unlikely possibility.
It is possible that animals that maintain a high level of
CD4+ T cell-mediated help may mount a persistently high
level of virus-specific CTLs. The number of infected animals that we have studied to date is too few to allow us to
assess this possibility.
The use of this approach for studying CTL responses in
vivo will, in the end, be limited only by the technique's
sensitivity. As currently performed, this flow cytometry-
based technique can detect CTLs only if they are represented in >0.1 to 0.5% of the CD8
/
+ T cell population.
A number of technical changes in this approach would
probably significantly enhance its sensitivity. Changes in
the dye and/or different laser configurations might increase the ability to discriminate between tetramer binding and
nonbinding CD8
/
+ T cell populations. Such changes
might make it possible to examine CTL responses to less
dominant epitopes than the Mamu-A*01-restricted Gag
peptide evaluated in this study.
The application of this novel technology in the SIVmac-infected rhesus monkey provides an important new approach for studying the role of CTLs in the immunopathogenesis of AIDS. It also provides a simple and quantitative approach for evaluating potential new vaccine strategies for preventing AIDS virus infections.
| |
Footnotes |
|---|
Address correspondence to Norman L. Letvin, Division of Viral Pathogenesis, Department of Medicine, Beth Israel Deaconess Medical Center, RE113, Harvard Medical School, Boston, MA 02215. Phone: 617-667-2766; Fax: 617-667-8210; E-mail: nletvin{at}bidmc.harvard.edu
Received for publication 26 November 1997 and in revised form 2 February 1997.
The authors thank Dr. Andrew J. McMichael for his encouragement in pursuing these studies and Dr. David N. Garboczi for the gift of the E. coli strain XA90 and advice in making the MHC class I-peptide complex.
This work was supported by National Institutes of Health grants AI-20729, AI-35166, AI-43068, AI-32426, AI-41913, RR-00168, and RR-00167, and Coulter Corp. (Miami, FL).
Abbreviations used in this paper
2m,
2-microglobulin;
1-D IEF, one-dimensional isoelectric focusing;
APC, allophycocyanin;
B-LCL, B lymphoblastoid
cell line;
CD, cluster of differentiation;
LDA, limiting dilution assay;
mac, macaque;
p11C, 12-amino acid fragment of SIVmac 251 Gag (amino acids
179-190);
p11C, C-M, 9-amino acid fragment of SIVmac 251 Gag
(amino acids 181-189);
pCTL, precursor frequency of CTLs;
SIV, simian
immunodeficiency virus.
| |
References |
|---|
|
|
|---|
| 1. |
Altman, J.D.,
P.A.H. Moss,
P.J.R. Goulder,
D.H. Barouch,
M.G. McHeyzer-Williams,
J.I. Bell,
A.J. McMichael, and
M.M. Davis.
1996.
Phenotypic analysis of antigen-specific T
lymphocytes.
Science.
274:
94-96
|
| 2. |
Koup, R.A.,
J.T. Safrit,
Y. Cao,
C.A. Andrews,
G. McLeod,
W. Borkowski,
C. Farthing, and
D.D. Ho.
1994.
Temporal
association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus
type 1 syndrome.
J. Virol.
68:
4650-4655
|
| 3. |
Reimann, K.A.,
K. Tenner-Racz,
P. Racz,
D.C. Montefiori,
Y. Yasutomi,
W. Lin,
B.J. Ransil, and
N.L. Letvin.
1994.
Immunopathogenic events in the acute infection of rhesus
monkeys with simian immunodeficiency virus of macaques.
J. Virol.
68:
2362-2370
|
| 4. | Rinaldo, C., X.L. Huang, Z.F. Fan, M. Ding, L. Beltz, A. Logar, D. Panicali, G. Mazzara, J. Liebmann, M. Cottrill, and P. Gupta. 1995. High levels of anti-human immunodeficiency virus type 1 (HIV-1) memory cytotoxic T-lymphocyte activity and low viral load are associated with lack of disease in HIV-1-infected long-term nonprogressors. J. Virol. 69: 5838-5842 [Abstract]. |
| 5. |
Tsubota, H.,
C.I. Lord,
D.I. Watkins,
C. Morimoto, and
N.L. Letvin.
1989.
A cytotoxic T lymphocyte inhibits acquired immunodeficiency syndrome virus replication in peripheral blood lymphocytes.
J. Exp. Med.
169:
1421-1434
|
| 6. |
Walker, C.M.,
D.J. Moody,
D.P. Stites, and
J.A. Levy.
1986.
CD8+ lymphocytes can control HIV infection in vitro by
suppressing virus replication.
Science.
234:
1563-1566
|
| 7. | Miller, M.D., H. Yamamoto, A.H. Hughes, D.I. Watkins, and N.L. Letvin. 1991. Definition of an epitope and MHC class I molecule recognized by Gag-specific cytotoxic T lymphocytes in SIVmac-infected rhesus monkeys. J. Immunol. 147: 320-329 [Abstract]. |
| 8. |
Miller, M.D.,
S. Gould-Fogerite,
L. Shen,
R.M. Woods,
S. Koenig,
R.J. Mannino, and
N.L. Letvin.
1992.
Vaccination
of rhesus monkeys with synthetic peptide in a fusogenic proteoliposome elicits simian immunodeficiency virus-specific
CD8+ cytotoxic T lymphocytes.
J. Exp. Med.
176:
1739-1744
|
| 9. | Yasutomi, Y., S. Koenig, S.S. Haun, C.K. Stover, R.K. Jackson, P. Conard, A.J. Conley, E.A. Emini, T.R. Fuerst, and N.L. Letvin. 1993. Immunization with recombinant BCG-SIV elicits SIV-specific cytotoxic T lymphocytes in rhesus monkeys. J. Immunol. 150: 3101-3107 [Abstract]. |
| 10. | Yasutomi, Y., T.J. Palker, M.B. Gardner, B.F. Haynes, and N.L. Letvin. 1993. Synthetic peptide in mineral oil adjuvant elicits simian immunodeficiency virus-specific CD8+ cytotoxic T lymphocytes in rhesus monkeys. J. Immunol. 151: 5096-5105 [Abstract]. |
| 11. |
Shen, L.,
Z.W. Chen,
M.D. Miller,
V. Stallard,
G.P. Mazzara,
D.L. Panicali, and
N.L. Letvin.
1991.
Recombinant virus vaccine-induced SIV-specific CD8+ cytotoxic T lymphocytes.
Science.
252:
440-443
|
| 12. | Allen, T.M., J. Sidney, M.-F. del Guercio, R.L. Glickman, G.L. Lensmeyer, D.A. Wiebe, R. DeMars, C.D. Pauza, R.P. Johnson, A. Sette, and D.I. Watkins. 1998. Characterization of the peptide binding motif of a rhesus MHC class I molecule (Mamu-A*01) that binds an immunodominant CTL epitope from SIV. J. Immunol. In press. |
| 13. | Shatz, P.J.. 1993. Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme: a 13 residue consensus peptide specifies biotinylation in Escherichia coli. Biotechnology. 11: 1138-1143 [Medline]. |
| 14. |
Garboczi, D.N.,
D.T. Hung, and
D.C. Wiley.
1992.
HLA-A2-peptide complexes: refolding and crystallization of molecules expressed in Escherichia coli and complexed with single
antigenic peptides.
Proc. Natl. Acad. Sci. USA.
89:
3429-3433
|
| 15. | Watkins, D.I., M. Kannagi, M.S. Stone, and N.L. Letvin. 1988. Major histocompatibility complex class I molecule of nonhuman primates. Eur. J. Immunol. 18: 1425-1432 [Medline]. |
| 16. | Yamamoto, H., M.D. Miller, H. Tsubota, D.I. Watkins, G.P. Mazzara, V. Stallard, D.L. Panicali, A. Aldovini, R.A. Young, and N.L. Letvin. 1990. Studies of cloned simian immunodeficiency virus-specific T lymphocytes: gag-specific cytotoxic T lymphocytes exhibit a restricted epitope specificity. J. Immunol. 144: 3385-3391 [Abstract]. |
| 17. | Fazekas de St. Groth, S. 1982. The evaluation of limiting dilution assays. J. Immunol. Methods. 49: R11-R23 [Medline]. |
| 18. |
Baume, D.M.,
M.A. Caligiuri,
T.J. Manley,
J.F. Daley, and
J. Ritz.
1990.
Differential expression of CD8 and CD8 associated with MHC-restricted and non-MHC-restricted cytolytic effector cells.
Cell. Immunol.
131:
352-365
[Medline].
|
| 19. | Moebius, U., G. Kober, A.L. Griscelli, T. Hercend, and S.C. Meuer. 1991. Expression of different CD8 isoforms on distinct human lymphocyte subpopulations. Eur. J. Immunol. 21: 1793-1800 [Medline]. |
| 20. | Norment, A.M., and D.R. Littman. 1988. A second subunit of CD8 is expressed in human T cells. EMBO (Eur. Mol. Biol. Organ.) J. 7: 3433-3439 [Medline]. |
| 21. |
Terry, L.A.,
J.P. DiSanto,
T.N. Small, and
N. Flomemberg.
1990.
Differential expression and regulation of human CD8
and CD8 chains.
Tissue Antigens.
35:
82-91
[Medline].
|
| 22. | Alcover, A. 1995. CD8 cluster report. In Leucocyte Typing V, White Cell Differentiation Antigens. Vol. 1. S.F. Schlossman, L. Boumsell, W. Gilks, J.M. Harlan, T. Kishimoto, C. Morimoto, J. Ritz, S. Shaw, R. Siverstein, T. Springer, T.F. Tedder, and R.F. Todd, editors. Oxford University Press, Oxford. 353-354. |
| 23. | Rocha, B., P. Vassalli, and D. Gui-Grand. 1992. The extrathymic T-cell development pathway. Immunol. Today. 13: 449-454 [Medline]. |
| 24. |
Gotch, F.M.,
D.F. Nixon,
N. Alp,
A.J. McMichael, and
L.K. Borysiewicz.
1990.
High frequency of memory and effector
gag specific cytotoxic T lymphocytes in HIV seropositive individuals.
Int. Immunol.
2:
707-712
|
| 25. |
Koup, R.A.,
C.A. Pikora,
K. Luzuriaga,
D.B. Brettler,
E.S. Day,
G.P. Mazzara, and
J.L. Sullivan.
1991.
Limiting dilution
analysis of cytotoxic T lymphocytes to human immunodeficiency virus gag antigens in infected persons: in vitro quantitation of effector cell populations with p17 and p24 specificities.
J. Exp. Med.
174:
1593-1600
|
| 26. |
Carmichael, A.,
X. Jin,
P. Sissons, and
L. Borysiewicz.
1993.
Quantitative analysis of the human immunodeficiency virus
type 1 (HIV-1)-specific cytotoxic T lymphocyte (CTL) response at different stages of HIV-1 infection: differential CTL
responses to HIV-1 and Epstein-Barr virus in late disease.
J.
Exp. Med.
177:
249-256
|
| 27. |
Moss, P.A.H.,
S.L. Rowland-Jones,
P.M. Frodsham,
S. McAdam,
P. Giangrande,
A.J. McMichael, and
J.I. Bell.
1995.
Persistent high frequency of human immunodeficiency
virus-specific cytotoxic T cells in peripheral blood of infected
donors.
Proc. Natl. Acad. Sci. USA.
92:
5773-5777
|
| 28. | Ho, H.-N., L.E. Hultin, R.T. Mitsuyasu, J.L. Matud, M.A. Hausner, D. Bockstoce, C.-C. Chou, S. O'Rourke, J.M.G. Taylor, and J.V. Giorgi. 1993. Circulating HIV-specific CD8+ cytotoxic T cells express CD38 and HLA-DR antigens. J. Immunol. 150: 3070-3079 [Abstract]. |
| 29. |
Pantaleo, G.,
A. De Maria,
S. Koenig,
L. Butini,
B. Moss,
M. Baseler,
H.C. Lane, and
A.S. Fauci.
1990.
CD8+ T lymphocytes of patients with AIDS maintain normal broad cytolytic
function despite the loss of human immunodeficiency virus-
specific cytotoxicity.
Proc. Natl. Acad. Sci. USA.
87:
4818-4822
|
| 30. |
Fiorentino, S.,
M. Dalod,
D. Olive,
J.-G. Guillet, and
E. Gomard.
1996.
Predominant involvement of CD8+CD28
lymphocytes in human immunodeficiency virus-specific cytotoxic activity.
J. Virol.
70:
2022-2026
[Abstract].
|
| 31. | Dalod, M., S. Fiorentino, C. Delamare, C. Rouzioux, D. Sicard, J.-G. Guillet, and E. Gomard. 1996. Delayed virus-specific CD8+ cytotoxic T lymphocyte activity in an HIV-infected individual with high CD4+ cell counts: correlations with various parameters of disease progression. AIDS. Res. Hum. Retroviruses. 12: 497-506 [Medline]. |
| 32. | Couedel-Courteille, A., R. Le Grand, M. Tulliez, J.-G. Guillet, and A. Venet. 1997. Direct ex vivo simian immunodeficiency virus (SIV)-specific cytotoxic activity detected from small intestine intraepithelial lymphocytes of SIV-infected macaques at an advanced stage of infection. J. Virol. 71: 1052-1057 [Abstract]. |
| 33. |
Musey, L.,
J. Hughes,
T. Schackter,
T. Shea,
L. Corey, and
M.J. McElrath.
1997.
Cytotoxic-T-cell responses, viral load,
and disease progression in early human immunodeficiency virus type 1 infection.
N. Engl. J. Med.
337:
1306-1308
|
This article has been cited by other articles: