|
||
By

From * The Center for Blood Research and Harvard Medical School, Department of Pathology,
Boston, Massachusetts 02115; and the
Department of Adult Oncology, Dana-Farber Cancer
Institute and Harvard Medical School, Boston, MA 02115
| |
Abstract |
|---|
|
|
|---|
Migration of mature B lymphocytes within secondary lymphoid organs and recirculation between these sites are thought to allow B cells to obtain T cell help, to undergo somatic hypermutation, to differentiate into effector cells, and to home to sites of antibody production. The
mechanisms that direct migration of B lymphocytes are unknown, but there is evidence that G
protein-coupled receptors, and possibly chemokine receptors, may be involved. Stromal cell-
derived factor (SDF)-1
is a CXC chemokine previously characterized as an efficacious
chemoattractant for T lymphocytes and monocytes in peripheral blood. Here we show with
purified tonsillar B cells that SDF-1
also attracts naive and memory, but not germinal center
(GC) B lymphocytes. Furthermore, GC B cells could be converted to respond to SDF-1
by
in vitro differentiation into memory B lymphocytes. Conversely, the migratory response in naive and memory B cells was significantly reduced after B cell receptor engagement and CD40
signaling. The receptor for SDF-1, CXC chemokine receptor 4 (CXCR4), was found to be
expressed on responsive as well as unresponsive B cell subsets, but was more rapidly downregulated on responsive cells by ligand. Finally, messenger RNA for SDF-1 was detected by in situ
hybridization in a layer of cells surrounding the GC. These findings show that responsiveness
to the chemoattractant SDF-1
is regulated during B lymphocyte activation, and correlates
with positioning of B lymphocytes within a secondary lymphoid organ.
| |
Introduction |
|---|
|
|
|---|
Mature B lymphocytes are known to localize to distinct microenvironments within secondary lymphoid organs such as the spleen, peripheral and mesenteric lymph nodes, and Peyer's patches in the gut. In the spleen, these microenvironments are located in the white pulp and support antigen- and costimulus-dependent proliferation in the T cell zone (periarteriolar lymphocyte sheath, PALS) and affinity maturation in the germinal center (GC)1 within the B cell area or follicle. Corresponding compartments can be found in the other secondary lymphoid organs. Early studies in the rat have shown that recirculating B cells collected from the thoracic duct home to the follicular mantle zone, i.e., the B cell area surrounding GCs, but not to the GC itself (1, 2). A large body of work on the generation of T cell-dependent antibody responses suggests that B lymphocytes after encounter of antigen and B cell receptor (BCR) engagement are initially activated by cognate interaction with T lymphocytes in the T cell zone (3). B cells then move to the follicle where they form germinal centers in which they undergo somatic hypermutation and affinity maturation. After the GC reaction wanes, some memory B cells are thought to remain in close proximity to follicular dendritic cells within the B cell area, whereas others recirculate or migrate together with antibody-secreting cells into the bone marrow (6).
The regulated movement of B lymphocytes into supportive niches is thought to prevent autoreactivity. Goodnow and coworkers have demonstrated that in the presence of a polyclonal B cell repertoire, a process termed follicular exclusion hinders autoreactive B cells from entering the B cell zone, which is a prerequisite for their survival in the absence of T cell help (7). Follicular exclusion has been proposed to be due to subtle differences between autoreactive and nonautoreactive B cells in responsiveness to positioning cues and is thought to be a checkpoint for censoring autoreactive B cells from the preimmune repertoire (9). This concept has recently been challenged by studies showing that BCR engagement and not the presence or absence of a polyclonal B cell repertoire is the key factor that leads to arrest of B cells in the outer periarteriolar lymphoid sheath (10, 11).
The molecular mechanisms that govern localization of B cells within secondary lymphoid organs and between these sites are unknown, but some studies suggest the involvement of seven transmembrane receptors and signaling through pertussis-toxin-sensitive G proteins. Goodnow's group has shown in transfer experiments that pretreatment with pertussis-toxin inhibits the migration of B and T cells into the splenic white pulp indicating that a G protein- coupled receptor, and perhaps one that binds a chemotactic factor, may be necessary for attraction of lymphocytes into the white pulp (12). A recent study provides evidence for a role of the putative chemokine receptor Burkitt's lymphoma receptor 1 (BLR1) in B cell migration. The phenotype of BLR1-deficient mice suggests the importance of this receptor in the localization of B lymphocytes within follicles in the spleen (13).
The role of chemotactic factors in directing granulocytes, macrophages, and T lymphocytes from the bloodstream into sites of inflammation has been extensively investigated (14, 15), but very little is known about B
lymphocyte chemoattractants and their receptors. To characterize chemoattractant-induced B cell migration, we carried out chemotaxis assays with stromal cell-derived factor
(SDF)-1
, which we have shown to be an efficacious
chemoattractant for monocytes and lymphocytes, including
the CD4+ and CD8+ T lymphocyte subsets, and the
CD45RA+ naive and CD45RO+ memory T lymphocyte
subsets in peripheral blood (16). SDF-1 is unique among
chemotactic cytokines. Formally, SDF-1 belongs to the
CXC subfamily of a family of small, 60-80 amino acid
chemotactic cytokines termed chemokines. All other human CXC chemokine genes cluster on chromosome 4; the
sdf-1 gene is located on chromosome 10 (17). SDF-1 is
with 99% identity between mouse and human the most
highly conserved cytokine described to date (16, 17). Mice
genetically deficient in SDF-1 lack B lymphocytes, lack
myelopoiesis in the bone marrow, and show defects in
heart development (18). Such a severe phenotype has not
been described for any other chemokine and demonstrates
wide importance for SDF-1 in both hematopoietic and
nonhematopoietic organs. The defect in B cell development is in agreement with the finding that SDF-1 functions
as a pre-B cell growth-stimulating factor (19).
It has recently been shown that SDF-1
binds the CXC
chemokine receptor 4 (CXCR4; references 20, 21). CXCR4,
also known as LESTR/fusin, facilitates entry of T cell line-
tropic strains of HIV-1 into CD4-expressing cells (22). By
binding to CXCR4, SDF-1
blocks infection by these
strains of HIV-1 (20, 21). Expression of CXCR4 messenger RNA (mRNA) has been detected in a wide variety of
tissues (23) and we have found expression of CXCR4
on T and B lymphocytes on the protein level (26).
B lymphocytes differ from T lymphocytes in that they
can undergo a second round of antigen receptor editing.
During development, both T and B lymphocytes go
through VDJ recombination in a primary lymphoid organ.
However, after encounter of antigen, B lymphocytes undergo somatic hypermutation, and also further recombination, in a specialized microenvironment in secondary lymphoid organs, the GC. The surface phenotype of tonsillar B
cells are characteristic for the localization in the different
compartments of the human tonsil and have been well
characterized. Here, we investigate the responsiveness to
SDF-1
of tonsillar B lymphocytes with distinct surface
phenotypes corresponding to different microenvironments within this secondary lymphoid organ.
| |
Materials and Methods |
|---|
|
|
|---|
Cytokines, Chemokines, and Antibodies.
IL-2 was a kind gift of Dr. J. Ritz (Dana Farber Cancer Institute, Boston, MA) and IL-10 was purchased from Genzyme (Cambridge, MA). Synthetic, human SDF-1
(1-67) (20) was a gift of Dr. I. Clark-Lewis (University of British Columbia, Vancouver, Canada). IL-8, macrophage
inflammatory protein (MIP)-1
, MIP-1
, monocyte chemoattractant (MCP)-1, and regulated on activation normal T cell expressed and secreted (RANTES) were obtained from Genzyme, monokine induced by IFN-
(Mig) from PharMingen (San Diego, CA), interferon-inducible protein 10 (IP10) from R&D Sys.
Inc. (Minneapolis, MN), and lymphotactin from Peprotec
(Rocky Hill, NJ). The following mAbs and polyclonal antibodies
were used for staining of surface antigens: anti-kappa-FITC was
obtained from Dako (Carpinteria, CA); anti-intercellular adhesion molecule (ICAM)-1-PE, and anti-CD20-FITC and -PerCP,
anti-CD44-FITC, anti-CD56-FITC, anti-CD62 ligand (L)-FITC, anti-CD3-PerCP, anti-CD14-PE, and anti-CD38-PE from Becton Dickinson (San Jose, CA); anti-CD38-TC from CALTAG
Labs. (Burlingame, CA); anti-lymphocyte function-associated antigen (LFA)-3-FITC (CD58) from Amac (Westbrook, ME); anti-CXCR4-PE (12G5) from PharMingen; anti-B7.1 (CD80) was
obtained from Repligen (Cambridge, MA) and conjugated with
FITC in our laboratory. The CCR3-specific mAb 7B11 (27) was
a gift from Dr. C.R. Mackay (LeukoSite Inc., Cambridge, MA),
and the mAb 12G5 against CXCR4 (28) was supplied by Dr. J. Hoxie (University of Pennsylvania, Philadelphia, PA). Unconjugated mAbs directed against CD38, CD44, kappa, and lambda
light chain were obtained from Immunotech (Westbrook, ME),
and mAbs against CD14 and CD3 from Coulter Corp. (Miami,
FL). An mAb against CD40 was purchased from the American
Type Culture Collection (Rockville, MD). The annexin V apoptosis detection assay was carried out according to the manufacturer's recommendations (R&D Sys. Inc.).
B Lymphocyte Purification.
Fresh tonsils were obtained from the Massachusetts Eye and Ear Infirmary (Boston, MA). Tonsils were mechanically homogenized. Tonsillar B lymphocytes were obtained from the single cell suspension by rosetting with sheep red blood cells (BioWhittaker, Walkersville, MD). The purity of tonsillar B cells obtained with this method was routinely >96% as estimated by FACScan® analysis (Becton Dickinson, San Jose, CA) using mAb to CD20, CD19, CD3, CD4, CD8, and CD14. Subsets of tonsillar B cells were purified by negative selection using a magnetic cell separation protocol (MACS; Miltenyi Biotec, Sunnyvale, CA). In brief, tonsillar B cells were incubated with mAbs specific for CD3, CD14, and either CD38 (for naive and memory B cell preparation), or CD44 (for GC B cell preparation), and subsequently with magnetic beads coated with anti-mouse IgG antibodies. Unstained cells were separated on a MACS column applying a magnetic field. The purity of CD38+CD44
GC B
cells and CD38
CD44+ naive and memory B cells was routinely
>97% as estimated by FACScan® analysis. Three-color flow cytometry was carried out as previously described (26). For chemokine
receptor downmodulation, tonsillar B cells were incubated for 30 min at 37°C or 4°C in RPMI-1640 containing 0.25% human serum albumin in the presence or absence of 2 µg/ml SDF-1
,
washed twice, and stained using the appropriate mAbs.
Chemotaxis Assays.
Chemotaxis assays were carried out as described (16) with the exception that tonsillar B lymphocytes were migrated for a period of 4 h and B cell subsets for a period of 3 h. In brief, 5 × 105 B cells in 100 µl RPMI-1640 containing 0.25% human serum albumin were transmigrated through 5-µm pore size bare filter Transwell inserts (Costar, Cambridge, MA). Migrated cells were counted by FACS® analysis scatter gating on lymphocytes. For antibody inhibition, cells were incubated for 15 min with differing concentrations of mAb to CXCR4 (12G5) or CCR3 (7B11) before addition to the top chamber of the chemotaxis assay. Chemotaxis was then carried out in the presence of mAb to an optimal concentration of 1.5 µg/ml SDF-1
. For pertussis toxin treatment, CD38
naive and memory B lymphocytes
were incubated for 2 h at 37°C with 200 ng/ml pertussis toxin
(GIBCO BRL, Gaithersburg, MD), washed twice, and subsequently added to the top chamber of the chemotaxis assay. Results are shown as percentage of total input or specific migration
after subtraction of background migration to control medium.
Actin polymerization.
Actin polymerization was tested as described (16, 29). In brief, human B cell subsets (1.25 × 106/ml) were incubated in L15 medium at 37°C with or without SDF-1
at 1.5 µg/ml. At the indicated time points, cells (400 µl) were added to 100 µl of a solution containing 4 × 10
7 M FITC-labeled phalloidin, 0.5 mg/ml L-
-lysophosphatidylcholine (both
Sigma Chemical Co., Milwaukee, WI), and 18% formaldehyde in
PBS. The fixed cells were subjected to fluorescence flow cytometry and the mean relative fluorescence of each sample determined. All data points are plotted relative to the mean relative fluorescence of the sample before addition of chemoattractant.
In Vitro Generation of Memory B Cells.
Purified GC B cells were differentiated into memory type B cells in vitro as described (30). In brief, irradiated CD40L-transfected NIH3T3 cells (transfected [t]-CD40L; reference 31) were plated onto 24-well plates at 105 cells per well and adhered overnight. GC B cells were plated on t-CD40L in Iscove's modified Dulbecco's medium supplemented with 2% human AB serum, 1% human serum albumin, 50 µg/ml transferrin, 5 µg/ml insulin, and 15 µg/ml gentamicin (B cell medium) containing IL-2 (10 U/ml) and IL-10 (10 ng/ml). B cells were cultured at 37°C in 5% CO2 for 3 d followed by 4 d of reculture on freshly prepared t-CD40L cells in the presence of IL-2 and IL-10.Short-term BCR Cross-linking.
BCR and CD40 on CD38
naive and memory B cells were cross-linked for 2 h on Fc
RII
(CD32) transfectants. Irradiated CD32-transfected NIH3T3 cells
(t-CD32, a gift of Dr. J. Fingeroff, Dana-Farber Cancer Institute,
Boston MA) were plated onto 24-well plates at 1-1.5 × 105
cells/well and adhered overnight. mAbs to human kappa and
lambda light chain (2 µg/ml; both IgG1) with or without a mAb
to CD40 (10 µg/ml) were preincubated on t-CD32 cells in B cell
medium for 15 min before purified CD38
naive and memory B
cells were added at 106 cells/ml/well. An irrelevant mAb (IgG1)
was used as control. BCR/CD40 cross-linking was carried out
for 2 h at 37°C. Treated cells were assayed in the chemotaxis assay to an optimal concentration of SDF-1
of 1.5 µg/ml.
In Situ Hybridization.
Digoxigenin (DIG)-labeled SDF-1 RNA probes were prepared by cloning a reverse transcriptase PCR product from total human tonsillar RNA (5
-primer: GCCATGAACGCCAAGGTCGT and 3
-primer: CGGGTCAATGCACACTTGTC) into pCR-II (Invitrogen, San Diego, CA).
This PCR product contains sequence that is common to both
SDF-1
and SDF-1
. Two clones carrying the insert in either
orientation were identified and DIG-labeled sense and antisense
RNA probes were generated after linearization with HindIII using T7 RNA polymerase according to the manufacturer's recommendations (Boehringer Mannheim GmbH, Mannheim, Germany). Control RNA/DNA hybridization on nitrocellulose filters using the DIG nucleic acid detection kit (Boehringer Mannheim GmbH) showed equal incorporation of DIG label in the
two probes.
In situ hybridization was carried out on 10-µm frozen sections
of human tonsil as described (32). In brief, freshly prepared sections were delipidized in chloroform for 5 min and fixed in PBS
containing 4% paraformaldehyde. After fixation, sections were washed briefly once in PBS and twice in 2× standard saline citrate (SSC), and prehybridized with hybridization buffer containing 4×
SSC, 10% dextran sulfate, 1× Denhardt's solution, 2 mM EDTA, 50% deionized formamide, and 500 µg/ml herring sperm DNA
for 1 h at 37°C. Sections were subsequently covered with hybridization buffer containing 200 ng/ml DIG-labeled sense or antisense RNA probe at 37°C for 16 h. After washing the slides at
37°C with 2× SSC for 5 min and 60% formamide, 0.2× SSC for
15 min and subsequently at room temperature with 2× SSC for
10 min sections were blocked with a saturated solution of blocking reagent (Boehringer Mannheim GmbH) in 100 mM Tris-HCl (pH 7.5) and 150 mM NaCl for 30 min. Sections were then
incubated with a 1:200 dilution of alkaline phosphatase-conjugated anti-DIG antibody in the saturated blocking solution for 2 h.
After washing with 100 mM Tris-HCl (pH 7.5) and 150 mM
NaCl for 20 min, sections were developed over 16 h using nitroblue tetrazolium salt/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) according to the manufacturer's recommendations
(Boehringer Mannheim GmbH).
| |
Results |
|---|
|
|
|---|
To characterize chemotactic responses in B lymphocytes we used purified human
tonsillar B cells in a chemotaxis assay with bare polycarbonate filters with 5-µm pores as part of a Transwell insert (16,
33). In contrast to the Boyden chamber microchemotaxis assay, this assay allows the determination of the absolute
number of responsive cells and the collection and characterization of transmigrated cells. Tonsillar B lymphocytes
were chosen because they comprise subpopulations in multiple states of activation and differentiation that have been
well characterized according to their surface antigen expression and localization in tonsil (34). Using the bare
filter chemotaxis assay, we detected specific migration of a
small fraction of tonsillar B cells towards SDF-1
, which
peaked at a concentration of 1.5 µg/ml of the chemokine and showed the typical biphasic curve that is characteristic
for chemoattractant induced migration (Fig. 1 A, top). The
same concentration was found to be optimal for T lymphocyte chemotaxis (16). Depending on the donor, the percentage of responsive cells varied in nine independent experiments between 6 and 20% of total input (data not
shown). Chemotaxis of tonsillar B cells was partially inhibited by preincubation of input cells with the mAb 12G5
(28) directed against the receptor for SDF-1, CXCR4 (Fig.
1 A, bottom). Preincubation with a control mAb directed
against CCR3; reference 27) was without any effect. Since
SDF-1
-stimulated Ca2+ flux in CXCR4 transfectants is
only partially inhibited by mAb 12G5 (26) only partial inhibition of B lymphocyte chemotaxis to SDF-1
would be
expected. It also is possible that SDF-1
may use additional, as yet unidentified, receptors on B lymphocytes.
|
The CXC chemokines IL-8, Mig, and IP10, the CC
chemokines MIP-1
, MIP-1
, monocyte chemoattractant
protein 1, and regulated on activation normal T cell expressed and secreted (RANTES), the C chemokine lymphotactin, and the chemoattractant C5a were also tested for
their ability to induce chemotaxis in tonsillar B lymphocytes over a 1,000-fold concentration range in the same assay. None of the tested chemokines induced significant migration in at least two independent experiments. Although
a low amount of activity was seen with Mig and IP10 in
some experiments, this was not a consistent finding (data
not shown).
Responsive B Lymphocyte Subsets.
We collected and phenotyped transmigrated tonsillar
B cells. Three main subpopulations have been described (3,
34). GC B cells express CD38, high levels of CD20, and
little to no CD44 and surface immunoglobulin. B cells outside
the GC are negative for CD38, and express CD44 and intermediate levels of CD20. B cells outside the GC can be divided
into CD38
CD44+IgD+ naive and CD38
CD44+IgD
memory B lymphocytes. The input population of purified
tonsillar B cells contained about two-fold more CD38+
GC B cells than CD38
cells (Fig. 1 B, upper left). By contrast, almost all transmigrated cells were negative for CD38
(Fig. 1 B, upper right). Among transmigrated B lymphocytes, half were CD38
IgD+ naive and the other half were
CD38
IgD
memory B cells (Fig. 1 B, lower right). Both
subpopulations were present in the input population in a
similar 1:1 ratio (Fig. 1 B, lower left). CD38+ GC B cells
were consistently unresponsive in 11 independent experiments.
GC B cells are large, blast-like lymphocytes that are
thought to undergo somatic hypermutation within the specialized microenvironment of the GC. It is unlikely,
though, that the unresponsiveness to SDF-1
is due to the
increased size of GC B lymphocytes, since phytohemagglutinin-stimulated T lymphocyte blasts that are even larger in
size than GC B cells as estimated by forward light scatter readily respond to SDF-1
in the same assay (26). It has
been shown that isolated GC B cells rapidly undergo apoptosis (40). To monitor apoptosis among input tonsillar B
lymphocytes, we tested input cells at different time points
over the 4-h duration of the chemotaxis assay for binding
of annexin V. Loss of membrane phospholipid asymmetry,
which leads to surface binding of annexin V, is thought to
be an early marker of programmed cell death (41). We
found that after 2 h, ~20% and after 4 h, ~30% of input
cells bound annexin V, indicating that the majority of input
GC cells remained intact during the course of the assay.
To confirm the unresponsiveness of GC B lymphocytes
to SDF-1
we carried out chemotaxis assays with isolated
B cell subsets. Purified CD38+ GC B cells showed little, if
any, specific migration above background (Fig. 2 A),
whereas 50-80% of isolated CD38
naive and memory B
lymphocytes migrated to an optimal concentration of SDF-1
of 1.5 µg/ml in the same assay (Fig. 2 A). Specific migration of these cells was completely abolished after pretreatment with pertussis toxin suggesting that the chemotactic
signal was dependent on a G
i-coupled receptor (Fig. 2 B).
|
As a second, independent assay that determines responsiveness to SDF-1
we carried out actin polymerization
experiments with CD38+ GC B cells versus CD38
B
cells. In this assay, changes in intracellular filamentous actin
(F-actin) were measured after exposure to SDF-1
over
time (29). There was a significant, transient increase in intracellular F-actin in purified CD38
naive and memory B
cells within 15 s after addition of SDF-1
, whereas F-actin
in purified CD38+ GC B cells showed little change compared to sham-treated cells (Fig. 3). The observed rapid increase in filamentous actin is characteristic for chemokine
induced actin polymerization and differs from stimulation
with phorbol esters and calcium ionophores (29, 42, 43).
The presented experiments suggest that B lymphocytes participating in the GC reaction are unresponsive to
chemotactic stimulation by SDF-1
.
|
The finding that the
differentiation state of a B lymphocyte correlates with its
responsiveness to chemokine prompted us to test if in vitro
differentiation of isolated cells would restore migratory
responses in the same cells. To this end we purified GC
B cells and differentiated them into memory type B
lymphocytes by culture on NIH3T3 cells expressing
CD40L over 7 d in the presence of IL-2 and IL-10 (30).
After 7 d, the majority of cultured cells had acquired the
CD38
CD20intermediateCD44+IgD
phenotype that is characteristic for memory B lymphocytes in vivo (Fig. 4 A).
L-selectin was induced and expression of intercellular adhesion molecule 1, lymphocyte function-associated antigen
3, and B7.1 was increased on cultured GC B cells when
compared to GC B cells before culture (Fig. 4 B). These
surface antigens are known to participate in lymphocyte
homing and lymphocyte-lymphocyte interaction (44, 45).
In parallel, specific migration to SDF-1
of these cells increased on average 27-fold during in vitro differentiation (average of three independent experiments; Fig. 4 C). The
percentage of responsive cells among in vitro generated
memory B cells was consistently lower than in experiments
using isolated CD38
naive and memory B lymphocytes
(Fig. 2 A). This may suggest that additional signals other
than CD40L, IL-2, and IL-10 are necessary to fully reconstitute migratory properties in memory B lymphocytes.
|
Since recent findings in the mouse suggest a key role for BCR engagement
in the localization of B cells within the white pulp in the
spleen (10, 11), we wished to determine what influence signaling through the BCR would have on the responsiveness of naive and memory B cells. Therefore, we cross-linked the BCR by incubating purified CD38
naive and
memory cells for 2 h with anti-kappa and -lambda light chain mAbs in the presence of NIH3T3 cells that express
Fc
RII (CD32). Compared to incubation with control
IgG, this treatment reduced SDF-1
-mediated chemotaxis
consistently by 50% (Fig. 5 A). Treatment for longer than 2 h
did not result in additional reduction in migration indicating that BCR cross-linking regulates responsiveness to
SDF-1
within hours. Adding an mAb specific for CD40
to the combination of anti-kappa and -lambda light chain mAbs under the same conditions led to an additional reduction in SDF-1
-induced migration (Fig. 5 A). In contrast, the anti-CD40 mAb alone had no effect on B cell
chemotaxis to SDF-1
(Fig. 5 A). To demonstrate the
specificity of the inhibitory effect of BCR cross-linking on
SDF-1
-induced migration, we incubated CD38
naive
and memory B cells for 2 h in the presence of NIH3T3
cells expressing Fc
RII with a lambda light chain-specific
mAb alone. After chemotaxis to an optimal concentration
of SDF-1
, input and transmigrated cells were stained for
kappa light chain expression (Fig. 5 B). BCR cross-linking
with an mAb specific for lambda light chain consistently led
to a selective reduction in the percentage of lambda-expressing
B lymphocytes in the transmigrated population compared
to the input population, as shown by the increase in the
percentage of transmigrated B cells that expressed kappa
chain.
|
.
Chemokine directed migration is mediated through G protein-coupled receptors. To investigate if the unresponsiveness of GC B lymphocytes was due to a lack of expression
of CXCR4, the receptor for SDF-1
, we stained tonsillar
B lymphocytes containing responsive and unresponsive
subsets with the CXCR4-specific mAb 12G5. We found
that both subsets express high levels of the receptor (Fig. 6 A).
Exposure to SDF-1
at 37°C downregulated surface expression of CXCR4. Interestingly, receptors on CD38
naive and memory B cells were more rapidly downregulated than on CD38+ GC B cells in multiple experiments,
with a 73 and 54% decrease, respectively, after 30 min (Fig.
6 B). The same treatment with SDF-1
carried out at 4°C
did not result in diminished binding of mAb 12G5 (not
shown). This finding indicates that the reduced binding of
CXCR4-specific mAb after treatment at 37°C is due to true downregulation of the receptor and not competition
of the antibody and the ligand for the same epitope.
|
To locate sites
of SDF-1 production within the human tonsil, we carried
out in situ hybridization studies on frozen sections of human tonsil. Using a RNA probe specific for both SDF-1
and SDF-1
we detected message for SDF-1 in cells
present in the connective tissue that forms the stationary
scaffold of the tonsil and in nonlymphoid cells that surround GCs (Fig. 7). Expression of SDF-1 was found to be
excluded from GCs and not to be associated with vascular
or epithelial components in the tonsillar tissue. The staining
found in the tonsil therefore suggests expression of SDF-1
in a specialized reticulum cell that lines the GC.
|
| |
Discussion |
|---|
|
|
|---|
SDF-1
induces migration in naive and memory B cells,
whereas GC B cells are unresponsive in assays measuring
chemotaxis and actin polymerization. B lymphocytes within
the GC maintain high levels of the SDF-1 receptor CXCR4.
Despite the expression of the appropriate chemokine receptor on these cells, there is no ligand-induced chemotaxis. Our studies further indicate that in comparison to naive and memory B cells, on GC B cells CXCR4 is more
slowly removed from the surface after addition of SDF-1
. Internalization of chemokine receptors within minutes after addition of agonist, as shown here for CXCR4 on naive
and memory B lymphocytes after addition of SDF-1
, has
been described for the fMLP and C5a receptors and is
thought to be an important mechanism to allow the continuous sampling of ambient chemoattractant concentration that is necessary to follow a chemotactic gradient (46).
It seems that in GC B cells, CXCR4 is less coupled to
downstream regulators that induce internalization of receptors than in migratory cells; there may be overlap between
these downstream regulators and those that signal chemotaxis.
The function of CXCR4 on GC B cells remains enigmatic. SDF-1 has previously been described to promote
growth of pre-B cells and has therefore been termed PBSF
for pre-B cell growth-stimulating factor (19). We have carried out preliminary experiments measuring apoptosis in
isolated GC B lymphocytes in the presence or absence of
SDF-1
and have failed to demonstrate a significant effect on inhibition of apoptosis in these cells. In addition, our in situ hybridization experiments indicate that expression of
SDF-1 is excluded from GCs. Thus, we have no indication
that SDF-1 serves as a growth factor or survival signal to
GC B cells that express its specific receptor CXCR4. It has
to be kept in mind that additional not yet identified factors
may use CXCR4 on B cells within GCs.
SDF-1
induces migration in naive and memory B cells,
but not in GC B cells. This observation suggests that B
lymphocytes undergoing somatic hypermutation within
GCs are unresponsive to cues that direct migration of naive
and memory B lymphocytes. In the mouse, Butcher's
group has shown that purified PNAhi GC B cells compared
to B cells outside of the GC do not home to secondary
lymphoid organs when transferred into syngeneic recipients (49). Although the lack of expression of the homing receptor L-selectin is thought to be a factor, other mechanisms
are likely to be involved since homing to the spleen, which
is L-selectin independent (50), was also impaired (49). The
authors have proposed that the nonmigratory phase is a
transient phenomenon that is related to a specific differentiation state within the confines of the GC microenvironment and our observation that in vitro differentiation of
GC B cells towards a memory phenotype restores responsiveness to SDF-1 supports this notion.
Responsiveness of B lymphocytes to SDF-1
is regulated by differentiation state and BCR signaling. In contrast
to the transition from unresponsive GC B cells to migratory effector B lymphocytes that developed over days in
culture, the responsiveness to SDF-1
in CD38
naive and
memory cells decreased rapidly after BCR signaling. Only
hours after BCR cross-linking, naive and memory B cells
migrated significantly slower than control cells, and this effect was increased by concomitant signaling through CD40.
CD40 signaling by itself was ineffective. Thus, while responsiveness of naive and memory B lymphocytes to SDF-1
is reduced after BCR cross-linking, these cells are thought
to migrate to the T cell areas of secondary lymphoid organs
after encounter of antigen (5, 51). This finding should not
be interpreted as contradictory to our results since SDF-1 is
unlikely to be the only chemotactic factor acting on B lymphocytes in lymphoid organs. Our finding may therefore suggest that the reduced responsiveness to SDF-1 allows a
B cell after encounter of antigen to migrate along a gradient of a different chemotactic factor leading it into the T
cell area. In this context, our observation that SDF-1
mRNA is found in a specialized reticulum cell that lines
GCs in the tonsil is particularly striking. The expression of
mRNA for SDF-1 in nonlymphoid cells surrounding GCs
correlates with the position of small recirculating naive and
memory B lymphocytes in the tonsil (38). Our finding is consistent with the previous isolation of SDF-1 protein or
mRNA from stromal cell lines, in this case derived from
the bone marrow (16, 19, 52). Our in situ hybridization results, therefore, further support the finding that responsiveness to SDF-1 correlates with the localization of B cell subsets within the tonsil.
Much is known about the events that allow emigration
of lymphocytes from the bloodstream, through high endothelial venules into secondary lymphoid organs (14, 15),
whereas little is known about the subsequent steps that direct migration of B and T lymphocytes into their respective
microenvironments. Our study shows that subsets of B
lymphocytes within a secondary lymphoid organ respond
to SDF-1
and that this responsiveness correlates with a
specific localization within this lymphoid organ and is regulated by the differentiation state of the cell and by BCR engagement. Migration of pro- and pre-B cells to SDF-1
has also recently been described in the mouse (53). Our
previous work demonstrated that naive and memory T
lymphocytes in the peripheral blood efficiently migrate towards an SDF-1
gradient (16). Chemokines may be important to direct migration of lymphocytes into supportive microenvironments and to maintain the specialized architecture of secondary lymphoid organs. Our work suggests
that SDF-1
may participate in this process, but further
work will be necessary to investigate the importance of
SDF-1 relative to other chemokines. The unresponsiveness
of GC B cells to SDF-1 may be due to alterations in downstream signaling pathways, and thus this may generalize to
other chemoattractant receptors. From work on the putative chemokine receptor BLR1, it becomes clear that distinct ligand-receptor pairs may be responsible for the positioning of B cells in the spleen and Peyer's patches versus
mesenteric and peripheral lymph nodes, since GC architecture is compromised in BLR1-deficient mice only in the
spleen and Peyer's patches (13). The situation is complicated by the fact that lymphocytes express multiple relevant chemokine receptors that allow detection of multiple concentration gradients, and they may influence each other
within a given microenvironment. Further work will be
necessary to identify other B lymphocyte chemoattractants
to address these questions.
| |
Footnotes |
|---|
Received for publication 22 September 1997 and in revised form 9 December 1997.
We are indebted to Sabine Michalak for excellent technical support. The authors thank Qing Ma for help with RNA probes and in situ hybridization and Cheryl Greene at the Massachusetts Eye and Ear Infirmary (Boston, MA) for supplying human tonsils.
; MIP, macrophage inflammatory protein;
mRNA, messenger RNA; SDF, stromal cell-derived factor; SSC, standard saline citrate; t, transfected.
| |
References |
|---|
|
|
|---|
| 1. | Nieuwenhuis, P., and W.L. Ford. 1976. Comparative migration of B- and T-lymphocytes in the rat spleen and lymph-nodes. Cell. Immunol. 23: 254-267 [Medline]. |
| 2. | Howard, J.C., S.V. Hunt, and J.L. Gowans. 1972. Identification of marrow-derived small lymphocytes in the lymphoid tissue and thoracic duct lymph of normal rats. J. Exp. Med. 135: 200-219 [Abstract]. |
| 3. | MacLennan, I.C.M.. 1994. Germinal centers. Annu. Rev. Immunol. 12: 117-139 [Medline]. |
| 4. | Rajewsky, K.. 1996. Clonal selection and learning in the antibody system. Nature. 381: 751-758 [Medline]. |
| 5. | Kelsoe, G.. 1996. Life and death in germinal centers (Redux). Immunity. 4: 107-111 [Medline]. |
| 6. |
Paramithiotis, E., and
M.D. Cooper.
1997.
Memory B lymphocytes migrate to bone marrow in humans.
Proc. Natl.
Acad. Sci. USA.
94:
208-212
|
| 7. | Cyster, J.G., S.B. Hartley, and C.C. Goodnow. 1994. Competition for follicular niches excludes self-reactive cells from the recirculating B-cell repertoire. Nature. 371: 389-395 [Medline]. |
| 8. | Cyster, J.G., and C.C. Goodnow. 1995. Antigen-induced exclusion from follicles and anergy are separate and complementary processes that influence peripheral B cell fate. Immunity. 3: 691-701 [Medline]. |
| 9. | Goodnow, C.C., J.G. Cyster, S.B. Hartley, S.E. Bell, M.P. Cooke, J.I. Healy, S. Akkaraju, J.C. Rathmell, S.L. Pogue, and K.P. Shokat. 1995. Self-tolerance checkpoints in B lymphocyte development. Adv. Immunol. 59: 279-368 [Medline]. |
| 10. |
Fulcher, D.A.,
A.B. Lyons,
S.L. Korn,
M.C. Cook,
C. Koleda,
C. Parish,
B. Fazekas de St,
Groth, and
A. Basten.
1996.
The fate of self-reactive B cells depends primarily on
the degree of antigen receptor engagement and availability of
T cell help.
J. Exp. Med.
183:
2313-2328
|
| 11. |
Cook, M.C.,
A. Basten,
B. Fazekas de St, and
Groth.
1997.
Outer periarteriolar lymphoid sheath arrest and subsequent
differentiation of both naive and tolerant immunoglobulin
transgenic B cells is determined by B cell receptor occupancy.
J. Exp. Med.
186:
631-643
|
| 12. |
Cyster, J.G., and
C.C. Goodnow.
1995.
Pertussis toxin inhibits migration of B and T lymphocytes into splenic white pulp cords.
J. Exp. Med.
182:
581-586
|
| 13. | Forster, R., A.E. Mattis, E. Kremmer, E. Wolf, G. Brem, and M. Lipp. 1996. A putative chemokine receptor, BLRI, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell. 87: 1037-1047 [Medline]. |
| 14. | Springer, T.A.. 1995. Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu. Rev. Physiol. 57: 827-872 [Medline]. |
| 15. | Butcher, E.C., and L.J. Picker. 1996. Lymphocyte homing and homeostasis. Science. 272: 60-66 [Abstract]. |
| 16. |
Bleul, C.C.,
R.C. Fuhlbrigge,
J.M. Casasnovas,
A. Aiuti, and
T.A. Springer.
1996.
A highly efficacious lymphocyte
chemoattractant, stromal cell-derived factor 1 (SDF-1).
J.
Exp. Med.
184:
1101-1110
|
| 17. | Shirozu, M., T. Nakano, J. Inazawa, K. Tashiro, H. Tada, T. Shinohara, and T. Honjo. 1995. Structure and chromosomal localization of the human stromal cell-derived factor 1 (SDF1) gene. Genomics. 28: 495-500 [Medline]. |
| 18. | Nagasawa, T., S. Hirota, K. Tachibana, N. Takakura, S.-I. Nishikawa, Y. Kitamura, N. Yoshida, H. Kikutani, and T. Kishimoto. 1996. Defects of B-cell lymphopoiesis and bone marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature. 382: 635-638 [Medline]. |
| 19. |
Nagasawa, T.,
H. Kikutani, and
T. Kishimoto.
1994.
Molecular cloning and structure of a pre-B-cell growth-stimulating
factor.
Proc. Natl. Acad. Sci. USA.
91:
2305-2309
|
| 20. | Bleul, C.C., M. Farzan, H. Choe, C. Parolin, I. Clark-Lewis, J. Sodroski, and T.A. Springer. 1996. The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature. 382: 829-833 [Medline]. |
| 21. | Oberlin, E., A. Amara, F. Bachelerie, C. Bessia, J.-L. Virelizier, A. Arenzana-Seisdedos, O. Schwartz, J.-M. Heard, I. Clark-Lewis, D.F. Legler, et al . 1996. The CXC chemokine, stromal cell derived factor 1 (SDF-1), is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1. Nature. 382: 833-835 [Medline]. |
| 22. | Feng, Y., C.C. Broder, P.E. Kennedy, and E.A. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science. 272: 872-877 [Abstract]. |
| 23. | Federsppiel, B., I.G. Melhado, A.M. Duncan, A. Delaney, K. Schappert, I. Clark-Lewis, and F.R. Jirik. 1993. Molecular cloning of the cDNA and chromosomal localization of the gene for a putative seven-transmembrane segment (7-TMS) receptor isolated from human spleen. Genomics. 16: 707-712 [Medline]. |
| 24. |
Nomura, H.,
B.W. Nielsen, and
K. Matsushima.
1993.
Molecular cloning of cDNAs encoding a LD78 receptor and putative leukocyte chemotactic peptide receptors.
Int. Immunol.
5:
1239-1249
|
| 25. |
Loetscher, M.,
T. Geiser,
T. O'Reilly,
R. Zwahlen,
M. Baggiolini, and
B. Moser.
1994.
Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes.
J. Biol. Chem.
269:
232-237
|
| 26. |
Bleul, C.C.,
L. Wu,
J.A. Hoxie,
T.A. Springer, and
C.R. Mackay.
1997.
The HIV coreceptors CXCR4 and CCR5
are differentially expressed and regulated on human T lymphocytes.
Proc. Natl. Acad. Sci. USA.
94:
1925-1930
|
| 27. | Heath, H., S. Qin, P. Rao, L. Wu, G. LaRosa, N. Kassam, P.D. Ponath, and C.R. Mackay. 1997. Chemokine receptor usage by human eosinophils. The importance of CCR3 demonstrated using an antagonistic monoclonal antibody. J. Clin. Invest. 99: 178-184 [Medline]. |
| 28. | Endres, M.J., P.R. Clapham, M. Marsh, M. Ahuja, J. Davis-Turner, A. McKnight, J.F. Thomas, B. Stoebenau-Haggarty, S. Choe, P.J. Vance, et al . 1996. CD4-independent infection by HIV-2 is mediated by fusin/CXCR4. Cell. 87: 745-756 [Medline]. |
| 29. |
Howard, T.H., and
W.H. Meyer.
1984.
Chemotactic peptide modulation of actin assembly and locomotion in neutrophils.
J. Cell Biol.
98:
1265-1271
|
| 30. |
Arpin, C.,
J. Dechanet,
C. Van Kooten,
P. Merville,
G. Grouard,
F. Briere,
J. Banchereau, and
Y.-J. Liu.
1995.
Generation of memory B cells and plasma cells in vitro.
Science.
268:
720-722
|
| 31. |
Schultze, J.L.,
A.A. Cardoso,
G.J. Freeman,
M.J. Seamon,
J. Daley,
G.S. Pinkus,
J.G. Gribben, and
L.M. Nadler.
1995.
Follicular lymphomas can be induced to present alloantigen
efficiently: a conceptual model to improve their tumor immunogenicity
Proc. Natl. Acad. Sci. USA.
92:
8200-8204
|
| 32. | Dijkman, H.B.P.M., S. Mentzel, A.S. de Jong, and K.J.M. Assmann. 1995. RNA in situ hybridization using digoxigenin-labeled cRNA probes. Biochemica. 2: 23-27 . |
| 33. | Roth, S.J., M.W. Carr, S.S. Rose, and T.A. Springer. 1995. Characterization of transendothelial chemotaxis of T lymphocytes. J. Immunol. Methods. 100: 97-116 . |
| 34. |
Lagresle, C.,
C. Bella, and
T. DeFrance.
1993.
Phenotypic and functional heterogeneity of the IgD B cell compartment: identification of two major tonsillar B cell subsets.
Int.
Immunol.
5:
1259-1268
|
| 35. | Liu, Y.-J., C. Barthélémy, O. de Bouteiller, C. Arpin, I. Durand, and J. Banchereau. 1995. Memory B cells from human tonsils colonize mucosal epithelium and directly present antigen to T cells by rapid up-regulation of B7-1 and B7-2. Immunity. 2: 239-248 [Medline]. |
| 36. |
Galibert, L.,
N. Burdin,
B. de Saint-Vis,
P. Garrone,
C. Van Kooten,
J. Banchereau, and
F. Rousset.
1996.
CD40 and B
cell antigen receptor dual triggering of resting B lymphocytes turns on a partial germinal center phenotype.
J. Exp. Med.
183:
77-85
|
| 37. |
Galibert, L.,
N. Burdin,
C. Barthelemy,
G. Meffre,
I. Durand,
E. Garcia,
P. Garrone,
F. Rousset,
J. Banchereau, and
Y.-J. Liu.
1996.
Negative selection of human germinal center
B cells by prolonged BCR cross-linking.
J. Exp. Med.
183:
2075-2085
|
| 38. | Hardie, D.L., G.D. Johnson, M. Khan, and I.C.M. MacLennan. 1993. Quantitative analysis of molecules which distinguish functional compartments within germinal centers. Eur. J. Immunol. 23: 997-1004 [Medline]. |
| 39. |
Pascual, V.,
Y.-J. Liu,
A. Magalski,
O. de Bouteiller,
J. Banchereau, and
J.D. Capra.
1994.
Analysis of somatic mutation in five B cell subsets of human tonsil.
J. Exp. Med.
180:
329-339
|
| 40. | Liu, Y.J., D.E. Joshua, G.T. Williams, C.A. Smith, J. Gordon, and I.C.M. MacLennan. 1989. Mechanism of antigen-driven selection in germinal centres. Nature. 342: 929-931 [Medline]. |
| 41. | Koopman, G., C.P.M. Reutelingsperger, G.A.M. Kuijten, R.M.J. Keehnen, S.T. Pals, and M.H.J. van Oers. 1994. Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood. 5: 1415-1420 . |
| 42. | Howard, T.M., and D. Wang. 1987. Calcium ionophore, phorbol ester, and chemotactic peptide-induced cytoskeleton reorganization in human neutrophils. J. Clin. Invest. 79: 1359-1364 . |
| 43. |
Sham, R.L.,
P.D. Phatak,
T.P. Ihne,
C.N. Abboud, and
C.H. Packman.
1993.
Signal pathway regulation of interleukin-8-induced actin polymerization in neutrophils.
Blood.
82:
2546-2551
|
| 44. | Springer, T.A.. 1990. Adhesion receptors of the immune system. Nature. 346: 425-433 [Medline]. |
| 45. | June, C.H., J.A. Bluestone, L.M. Nadler, and C.B. Thompson. 1994. The B7 and CD28 receptor families. Immunol. Today. 15: 321-331 [Medline]. |
| 46. | Van Epps, D.E., S. Simpson, J.G. Bender, and D.E. Chenoweth. 1990. Regulation of C5a and formyl peptide receptor expression on human polymorphonuclear leukocytes. J. Immunol. 144: 1062-1068 [Abstract]. |
| 47. | Gerard, C., and N.P. Gerard. 1994. C5a anaphylatoxin and its seven transmembrane-segment receptor. Annu. Rev. Immunol. 12: 775-808 [Medline]. |
| 48. | Giannini, E., and F. Boulay. 1995. Phosphorylation, dephosphorylation, and recycling of the C5a receptor in differentiated HL60 cells. J. Immunol. 154: 4055-4064 [Abstract]. |
| 49. |
Reichert, R.A.,
W.M. Gallatin,
I.L. Weissman, and
E.C. Butcher.
1983.
Germinal center B cells lack homing receptors necessary for normal lymphocyte recirculation.
J. Exp.
Med.
157:
813-827
|
| 50. | Arbones, M.L., D.C. Ord, K. Ley, H. Ratech, C. Maynard-Curry, G. Otten, D.J. Capon, and T.F. Tedder. 1994. Lymphocyte homing and leukocyte rolling and migration are impaired in L-selectin-deficient mice. Immunity. 1: 247-260 [Medline]. |
| 51. | Liu, Y.-J., and C. Arpin. 1997. Germinal center development. Immunol. Rev. 156: 111-126 [Medline]. |
| 52. |
Tashiro, K.,
H. Tada,
R. Heilker,
M. Shirozu,
T. Nakano, and
T. Honjo.
1993.
Signal sequence trap: A cloning strategy
for secreted proteins and type I membrane proteins.
Science.
261:
600-603
|
| 53. | D'Apuzzo, M., A. Rolink, M. Loetscher, J.A. Hoxie, I. Clark-Lewis, F. Melchers, M. Baggiolini, and B. Moser. 1997. The chemokine SDF-1, stromal cell-derived factor 1, attracts early stage B cell precursors via the chemokine receptor. Eur. J. Immunol. 27: 1788-1793 [Medline]. |
This article has been cited by other articles: