|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cells from
Multipotential Murine Bone Marrow Progenitors in a
Stroma-free Culture: Definition of Cytokine Requirements
and Developmental Intermediates
By


From the * Laboratory of Molecular Pathology, Department of Pathology, University of Texas
Southwestern Medical Center, Dallas, Texas 75235-9072; and
Immunology Department, DNAX
Research Institute of Molecular and Cellular Biology, Palo Alto, California 94304-1104
We have developed a stroma-free culture system in which mouse marrow or thymus cells,
known to be enriched for lymphoid progenitors, can be driven to generate natural killer (NK)
cells. Culture of lineage marker (Lin)
, c-kit+, Sca2+, interleukin (IL)-2/15R
(CD122)
marrow cells in IL-6, IL-7, stem cell factor (SCF), and flt3 ligand (flt3-L) for 5-6 d followed by
IL-15 alone for an additional 4-5 d expanded the starting population 30-40-fold and gave rise to a virtually pure population of NK1.1+, CD3
cells. Preculture in IL-6, IL-7, SCF, and flt3-L
was necessary for inducing IL-15 responsiveness in the progenitors because the cells failed to
significantly expand when cultured in IL-15 alone from the outset. Although culture of the
sorted progenitors in IL-6, IL-7, SCF, and flt3-L for the entire 9-11-d culture period caused
significant expansion, no lytic NK1.1+ cells were generated if IL-15 was not added, demonstrating a critical role for IL-15 in NK differentiation. Thus, two distinct populations of NK
progenitors, IL-15 unresponsive and IL-15 responsive, have been defined. Similar results were
obtained with Lin
, CD44+, CD25
, c-kit+ lymphoid progenitors obtained from adult thymus. The NK cells generated by this protocol lysed the NK-sensitive target YAC-1 and expressed markers of mature NK cells with the notable absence of Ly-49 major histocompatibility
complex (MHC) receptors. However, despite the apparent lack of these inhibitory MHC receptors, the NK cells generated could distinguish MHC class I+ from class I
syngeneic targets,
suggesting the existence of novel class I receptors.
NK cells express two families of receptors, which in the
murine system are known as NKR-P1 and Ly-49 (1).
The NKR-P1 molecule is expressed on all NK cells of certain mouse strains and may play a role in triggering NK cytotoxicity. Conversely, the Ly-49 receptors, which recognize class I MHC molecules, are expressed on subsets of
NK cells and inhibit NK-mediated lysis.
Despite increasing knowledge of NK cell function and
target cell recognition, differentiation of NK cells from hematopoietic stem cells is poorly understood. NK cells are
known to be bone marrow derived, and early work suggested an important role for the marrow microenvironment in generating mature lytic NK cells (2). To dissect the
steps of NK differentiation, several in vitro systems have
been established that allow the development of lytic NK cells
from CD34+ human cells (3) or unseparated rodent bone
marrow (reviewed in reference 7). However, in many of
these systems, the starting populations were heterogeneous,
containing pluripotent stem cells and progenitors at different stages of development. In addition, the NK cells that
developed were not fully characterized, especially with respect to the expression and function of class I MHC receptors.
Although IL-2 has frequently been used to support NK
development, the failure to detect the IL-2 gene product
within bone marrow stroma (8) and the presence of NK cells
in IL-2 In the present report, we describe an in vitro culture system yielding virtually pure populations of lytic NK1.1+ cells
from lineage (Lin) Animals.
7-12-wk C57BL/6 mice were bred at The University of Texas Southwestern Medical Center (Dallas, TX) and used
for bone marrow progenitor experiments. 4-5-wk (C57BL/6 × BALB/C)F1 mice (Jackson Labs., Bar Harbor, ME) were used for
thymic progenitor experiments.
mAbs.
Except as noted below, all mAbs and their isotype
controls were obtained from PharMingen (San Diego, CA). Anti-gp49B1 FITC (B23.1) was the gift of Dr. H. Katz (Harvard University, Boston, MA), anti-Ly-49G2 (4D11) and anti-Ly-49D (12A8)
were provided by Dr. J. Ortaldo (National Cancer Institute, Frederick, MD), anti-Ly-49A (JR9-318) was the gift of Dr. J. Roland
(Institut Pasteur, Paris, France), and anti-Sca2 hybridoma supernatant was provided by Dr. G. Spangrude (University of Utah, Salt
Lake City, UT). Goat anti-rat Cell Preparation, Isolation, and Analysis of Precursor Cells.
Cell
suspensions of bone marrow and thymocytes were prepared as
previously described (13, 14). Staining was performed on ice in
PBS/5 mM EDTA at 3 × 106 cells/ml. For three-color sorting
of bone marrow progenitors, cells were incubated with anti-Fc
/
mice (9) strongly suggests that cytokines other than
IL-2 participate in NK cell differentiation in vivo. The
newly described cytokine IL-15 has been shown to use
both the common
chain (
c) and IL-2R
as components
of its receptor (10), and it is produced by bone marrow
stromal cell cultures (8). In addition, IL-15 supports development of NK cells from human CD34+ stem cells and
murine fetal thymic cells (8, 11) and causes terminal differentiation of immature, nonlytic NK1.1+ cells found in the
spleen of marrow ablated mice (12).
, c-kit+, and Sca2+ multipotent progenitors in the absence of stroma. The data show that a
mixture of early acting cytokines and IL-15 play sequential and important roles in the differentiation of NK cells from
these marrow progenitors.
Texas red (Southern Biotechnology Assoc., Birmingham, AL) or streptavidin-Red670 (GIBCO
BRL, Gaithersburg, MD) was used to detect some primary antibodies.
RIII/II (2.4G2) and then with a mixture of lineage-specific
biotinylated antibodies: anti-B220 (RA3-6B2), anti-CD2 (RM2-5),
anti-Gr1 (RB6-8C5), anti-CD11b (M1/70), and anti-NK1.1
(PK136) followed by streptavidin magnetic beads (Miltenyi Biotec Inc., Auburn, CA). After washing, the cells were passed over a
CS column (Miltenyi Biotec Inc.) to remove Lin+ cells. The Lin-depleted population was then stained with streptavidin-Red670, c-kit (2B8) PE, and Sca2 (thymic shared antigen [TSA]1) FITC. Lin-Red670
, c-kit PE+, Sca2 FITC+ cells of lymphoid and blast size
were then sorted on a FACStar Plus® flow cytometer (Becton
Dickinson, San Jose, CA) using Lysis II software. The identification and isolation of CD4lo (CD44+, CD25
, c-kit+, Lin
) has
been previously described (14).
Texas red, 10% normal rat serum, the cocktail of biotinylated Lin-specific mAbs described above, and finally a mixture of streptavidin-Red670, c-kit FITC, or PE and either CD44 (IM7) PE,
IL-2/15R
(TM-
1) PE, HSA (M1/69) FITC, or CD4 (H129.19)
FITC. Analysis of cultured cells was performed by sequential staining with 2.4G2, a biotinylated mAb, and finally streptavidin-Red670 plus an FITC- and/or PE-conjugated mAb.
Culture Conditions.
Sorted Lin
, c-kit+, Sca2+ marrow cells
were cultured in 96-well U-bottomed plates (Falcon, San Jose, CA)
at 8,000-10,000 cells/well in 0.2 ml of complete RPMI-1640
(10% FBS, 100 U/ml streptomycin, 1 mM sodium pyruvate, 2 mM
glutamine, 1× nonessential amino acids, 50 µg/ml gentamicin, 5 × 10
5 M 2-mercaptoethanol, and 1 µg/ml Indomethacin) plus 20 ng/ml murine IL-15 (a gift from Dr. Tony Trout, Immunex
R&D Corp., Seattle, WA) or a mixture of 20 ng/ml murine IL-6
(PharMingen), 0.5 ng/ml murine IL-7 (PeproTech, Rocky Hill,
NJ), 50 ng/ml rat stem cell factor (SCF; a gift from Amgen,
Thousand Oaks, CA), and 100 U/ml murine flt3 ligand (flt3-L;
DNAX, Palo Alto, CA). The cells were refed with the same media on day 3, and then on day 5 or 6 the cultures were harvested,
washed, counted, and replated at 10,000-15,000/well in complete RPMI containing IL-15 alone or the mixture of cytokines described above. After an additional 3 d, the cultures were refed with the same media, and on day 11 or 12 of total culture time, the cells were harvested for analysis. Sorted Lin
, CD44+,
CD25
, c-kit+ thymic progenitors were cultured as previously
described (15), and the two-step culture protocol described above
for marrow progenitors was followed.
Target Cells and Cytotoxicity Assays. Tumor targets used were YAC-1 (H-2a); RMA (H-2b); a transport associated with antigen processing (Tap)-2 mutant derivative of RMA, RMA-S (H-2b); and a Tap-2 transfectant of RMA-S, Q11 (H-2b; reference 16), which was a kind gift of Dr. J. Monaco (University of Cincinnati, Cincinnati, OH). All cell lines were maintained in supplemented RPMI-1640 (17); Q11 additionally received 1 mg/ml G418. Target cells were used in a 4-h 51Cr cytotoxicity assay, and percent specific lysis was expressed as the mean ± SEM of triplicate wells and calculated as described earlier (17).
RNA Extraction, PCR Amplification, and Southern Analysis.
Total RNA was prepared from whole cells using a modification
of the Chomczynski and Sacchi method. Reverse transcription
was performed using the Superscript II system (GIBCO BRL)
and PCR using the GIBCO BRL PCR kit with standard PCR
buffer (1.5 mM MgCl2) for 35 cycles (94°C for 30 s, 55°C for 30 s,
72°C for 1 min). Primers were designed from the published IL-15R
sequence (18). Under these conditions, the forward primer
(CTCCAGGCTGACACCATC) and reverse primer (CATGGTTTCCACCTCAACACGGCA) yield a 282-bp product. PCR
products were transferred to Hybond N plus (Amersham Life Science Corp., Arlington Heights, IL) and probed with an end-labeled internal IL-15R
oligo (GAGAACGTCGTTGTTACTG) at
55°C. IL-2-cultured NK cells served as a positive control for
IL-15R
message, and RNA integrity was confirmed by amplification of glyceraldehyde-3-phosphate-dehydrogenase (GAPDH).
, c-kit+, Sca2+ Bone
Marrow Population.
We previously identified a multipotential bone marrow population characterized as Ly6 (Sca1)+,
Lin
, c-kit (CD117)+, CD43hi, Fall-3hi, Sca2 (TSA1)
,
AA4lo, and Rh123hi with both lymphoid and myeloid repopulating abilities in vivo (13). Upon adoptive transfer,
this population also gives rise to NK cells (13). To define a
population capable of giving rise to NK cells in vitro, a
marker more restricted to the lymphoid lineage was sought.
TSA-1, also known as Sca2 (19), was previously found to
delineate a population of Lin
, Thy-1lo, HSA (CD24)+ bone
marrow cells enriched for lymphoid (T and B cell) repopulating ability, but essentially devoid of pluripotent stem cells
(20). Because NK cells may share a common progenitor with
T and B cells (21) and may indeed derive from an NK/T
precursor (11, 22), we hypothesized that a marrow population expressing Sca2 may also contain NK progenitors. Thus,
a Lin (CD2, B220, Gr1, CD11b, NK1.1)
, c-kit+, Sca2+
population, representing ~1% of whole bone marrow, was
isolated. Four-color analysis revealed that these cells were
CD44hi, HSAint, and CD4
(data not shown). The phenotype of this population is similar to a CD4lo, CD8
, CD3
,
CD44+, Sca2+, c-kit+, CD25
lymphoid progenitor from
thymus (23) and to a related CD4
/lo, Lin
, Thy1lo, HSAint,
CD44hi, and Sca2+ population isolated from bone marrow
with predominant lymphoid and limited myeloid repopulating abilities (20).
, c-kit+, Sca2+ Multipotent Progenitors.
To
determine the ability of this "lymphoid-enriched" progenitor population to give rise to NK cells, sorted Lin
, c-kit+,
Sca2+ cells were cultured with IL-15 for 9-11 d. However,
these cells failed to expand significantly in IL-15 alone (Table 1). Cell recovery on average (n = 6) was only 1.8-fold
over the input numbers of cells, but these cells did lyse the
NK-sensitive tumor YAC-1 (Fig. 1). It is possible that a
small number of the progenitors are truly capable of responding to IL-15 alone. We do not favor this hypothesis
because cell surface expression of IL-2/15R
was not detected on the sorted population (Fig. 2 B), and the
chain is usually required for signal transduction (24). Alternatively, this growth may represent contamination by rare
mature NK cells.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
, c-kit+, Sca2+ cells cultured with a
cocktail of early acting cytokines ± IL-15. Sorted cells were cultured in
the indicated cytokines as described in Materials and Methods. Cytotoxic
activity was assessed on YAC-1 tumor cells. The data are representative of
six experiments.
messenger RNA and IL-2/
15R
on Lin
, c-kit+, Sca2+ progenitors and an IL-15-responsive
population derived by culture of
the progenitors in IL-6, IL-7, SCF,
and flt3-L. (A) IL-15R
message
levels were determined with RNA
isolated from sorted Lin
, c-kit+,
Sca2+ progenitors in two experiments (lanes 1 and 2) and from a
population of splenic NK cells (45%
NK1.1+ by flow cytometry) derived by culture of spleen cells in
500 U/ml of recombinant human
IL-2 for 4 d (lane 3). (B) IL-2/
15R
expression was examined by
flow cytometry on gated Lin
,
c-kit+, Sca2+ cells using PE-labeled
anti-IL-2/15R
mAb TM-
1.
The data are representative of three
experiments. (C) Sorted Lin
,
c-kit+, Sca2+ cells, cultured for 5 d
in IL-6, IL-7, SCF, and flt3-L,
were stained for IL-2/15R
expression using FITC-labeled TM-
1. Shaded curves represent staining with TM-
1, whereas open
curves represent staining with isotype control mAbs. The data are
representative of two experiments.
Although the sorted marrow progenitor cells failed to
expand significantly when cultured in IL-15 only, when
cultured for 5-6 d in IL-6, IL-7, SCF, and flt3-L and then
placed in IL-15 alone for an additional 4-5 d, significant
expansion occurred (Table 1), and the majority of cells generated were NK1.1+ and lytic (Table 1 and Fig. 1). If the
cultures were maintained in the original cocktail instead of
switching to IL-15, significant expansion again occurred, but
no lytic activity and few, if any, NK1.1+ cells were detectable. Together these data indicate that culture of sorted
Lin
, c-kit+, Sca2+ progenitors in the early acting cytokines causes expansion and primes at least some cells within
this population to respond to IL-15 alone. The identity of
other cells generated in the presence of the cytokine cocktail and absence of IL-15 is still being explored, but a small
fraction (~13%) are CD19+, sIgM
, indicative of immature B cells, whereas a larger fraction (~63%) express high
levels of CD11b. Thus, it appears that this population may
be multipotential. The data also point to a critical role for
IL-15 in NK differentiation because culture of the multipotential progenitors, "primed" by early cytokines in IL-15
only, generated a population of predominantly NK1.1+ cells.
Similar experiments were performed using immature thymic progenitors (Lin
, CD44+, CD25
, c-kit+, CD4lo) previously shown to generate T, B, and NK cells (14, 23). When
these cells were cultured with IL-15 alone, all cells died within 72 h (Table 2). However, like the marrow progenitor population, when this thymic population was cultured
in a cocktail of early acting cytokines and then switched to
culture with IL-15 only, significant expansion was observed
and a virtually pure population of NK1.1+ cells was generated. In initial experiments, the primary culture was performed in IL-3, IL-6, IL-7, and SCF because this mixture is known to maintain and expand lymphoid progenitors
(14). Because IL-3 is a T cell-derived cytokine that should
not be required for NK differentiation, we hypothesized
that the NK progenitors would develop in the absence of
IL-3. Indeed, culture in IL-6, IL-7, IL-15, SCF, and flt3-L
for 13 d generated large numbers of an 86% pure population of NK cells, whereas culture in the absence of IL-15
failed to give rise to NK1.1+ cells but did result in significant expansion (Table 2).
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
and IL-2/15R
by Sorted Population and Developmental Intermediates.
The ability of IL-6,
IL-7, SCF, and flt3-L to induce IL-15 responsiveness in
sorted Lin
, c-kit+, Sca2+ cells suggested that this mixture
of cytokines may be inducing expression of functional IL-15
receptors. Sorted Lin
, c-kit+, Sca2+ bone marrow cells were
thus examined for IL-15R
expression by PCR and IL-2/
15R
expression by FACS® analysis. Interestingly, the freshly
sorted cells did express transcripts of IL-15R
(Fig. 2 A),
but they failed to show cell surface expression of IL-2/
15R
(Fig. 2 B). Furthermore, preliminary evidence has
indicated surface expression of the
c by a small proportion
of these cells (data not shown). These data suggest that the
failure of sorted Lin
, c-kit+, Sca2+ cells to expand significantly in IL-15 alone is most likely due to the absence of
IL-2/15R
expression. We, therefore, anticipated that culture of Lin
, c-kit+, Sca2+ cells in IL-6, IL-7, SCF, and
flt3-L would induce IL-2/15R
expression. Indeed, after
primary culture, ~13% of the progenitors expressed IL-2/
15R
(Fig. 2 C), but not NK1.1 (data not shown). Upon
further culture in IL-15, the vast majority of the NK1.1+
cells generated also expressed IL-2/15R
(data not shown).
These data thus suggest that IL-2/15R
expression may precede that of NK1.1, and its acquisition may be a critical
event in NK cell differentiation. This idea is supported by
the absence of NK cells in IL-2/15R
/
mice (25) and
isolation of an IL-2/15R
+, NK1.1
population from SCID
bone marrow that can give rise to lytic NK1.1+ cells upon
culture in IL-15 (our unpublished data).
The NK
cells generated by culture of marrow progenitor cells were
phenotypically quite similar to mature IL-2-activated
splenic NK cells (12, 26, 27). They were CD3
, CD11b+,
Fc
RIII/II+, IL-2/15R
+, c-kit
, and 2B4+ (data not
shown) and lysed the NK-sensitive target YAC-1 (Fig. 1).
Interestingly, they also expressed gp49B1, an inhibitory receptor of the Ig superfamily shared by mast cells (28). However, they failed to express the Ly-49 family of MHC receptors (Fig. 3). In four experiments, expression of Ly-49A,
C/I, and D was undetectable or <3% over isotype controls, whereas mature C57BL/6 splenic NK1.1+ cells are
20% Ly-49A+, 50% Ly-49C/I+, and 50% Ly-49D+. Expression of Ly-49G2 was slightly more variable ranging from 2-8% over isotype controls, whereas nearly 50% of splenic
NK cells express this receptor. We have been unable to ascertain whether the in vitro-derived NK cells truly express
low levels of Ly-49G2 or whether this antibody simply shows
nonspecific binding. In any case, these data suggest that NK
cells acquire expression of NK1.1 before expression of Ly-49 receptors. The factors required for induction of Ly-49
molecules are unknown, but it is clear that IL-15 alone is
not sufficient.
,
c-kit+, Sca2+ progenitors. Expression of NK1.1 was analyzed by setting a
"live" gate based on forward and side scatter of the cells, whereas expression of the remainder of the markers was analyzed on NK1.1+, live cells.
Shaded curves represent staining with the NK1.1 or Ly49 mAbs, whereas
open curves represent staining with isotype control mAbs. The data are
representative of four separate experiments.
Cytotoxic Activity of In Vitro-generated NK Cells Against Class I+ and Class I
Tumor cells.
It has been demonstrated that interaction of Ly-49 receptors with their appropriate MHC class I ligands sends an inhibitory signal to NK
cells and prevents NK-mediated lysis of the class I+ target
(1). However, despite the failure to express significant levels of Ly-49 MHC receptors, these in vitro-derived NK
cells differentiated class I+ from class I
syngeneic tumor
cells. They lysed class Ilo Tap-deficient RMA-S cells but
failed to lyse RMA, the class I+ parent of RMA-S (Fig. 4).
That this difference in lysis was due to the absence of class I
on the surface of RMA-S is supported by the observation
that the culture-derived NK cells failed to lyse Q11, a class
I+ Tap-2 transfectant of RMA-S (16).
/
tumor cells by in vitro
generated NK cells. Target cells were class I+ RMA (Tap+/+) and Q11
(Tap+/+) and class Ilo RMA-S (Tap
/
). The data are representative of
three separate experiments.
In summary, we have developed a stroma-free culture
system capable of generating lytic NK1.1+ cells from a defined multipotential progenitor population contained in the
bone marrow. This system has allowed identification of a
putative (NK1.1
) developmental intermediate in NK differentiation, characterized by expression of IL-2/15R
and
the ability to respond to IL-15. One or all of a mixture of
cytokines including IL-6, IL-7, SCF, and flt3-L was shown
to be critical in reaching this developmental stage. This
study also provided additional evidence for the critical role
that IL-15 plays in NK differentiation, because no NK1.1+
cells were detected in its absence. IL-15 was not, however,
capable of inducing expression of the Ly-49 family of MHC
molecules, suggesting that some stimulus necessary to induce Ly-49 expression was missing from this culture system. Finally, these data suggested that development of lytic
activity and expression of NK1.1 can precede expression of
Ly-49 molecules; however, despite the absence of these receptors, the in vitro-derived NK cells could distinguish
class I+ from class I
syngeneic tumor cells, suggesting the
existence of novel class I receptors.
Address correspondence to Dr. Noelle S. Williams, Laboratory of Molecular Pathology, Department of Pathology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75235-9072. Phone: 214-648-4081; FAX: 214-648-4033; E-mail: williams.n{at}pathology.swmed.edu
Received for publication 30 June 1997 and in revised form 5 September 1997.
This work was supported by National Institutes of Health grants AI25401, AI38938, CA36922, and CA70134. DNAX Research Institute of Molecular and Cellular Biology is supported by Schering-Plough Corporation.
The authors would like to thank Angie Mobley and Bonnie Darnell for expert assistance in all aspects of flow cytometry and cell sorting.
| 1. | Brown, M.G., A.A. Scalzo, K. Matsumoto, and W.M. Yokoyama. 1997. The natural killer gene complex: a genetic basis for understanding natural killer cell function and innate immunity. Immunol. Rev. 155: 53-65 [Medline]. |
| 2. |
Kumar, V.,
J. Ben-Ezra,
M. Bennett, and
G. Sonnenfeld.
1979.
Natural killer cells in mice treated with 89Strontium:
normal target-binding cell numbers but inability to kill even
after interferon administration.
J. Immunol.
123:
1832-1838
|
| 3. |
Miller, J.S.,
C. Verfaillie, and
P. McGlave.
1992.
The generation of human natural killer cells from CD34+/DR primitive progenitors in long-term bone marrow culture.
Blood.
80:
2182-2187
|
| 4. |
Silva, M.R.G.,
R. Hoffman,
E.F. Srour, and
J.L. Ascensao.
1994.
Generation of human natural killer cells from immature progenitors does not require marrow stromal cells.
Blood.
84:
841-846
|
| 5. |
Shibuya, A.,
K. Nagayoshi,
K. Nakamura, and
H. Nakauchi.
1995.
Lymphokine requirement for the generation of natural
killer cells from CD34+ hematopoietic progenitor cells.
Blood.
85:
3538-3546
|
| 6. |
Bennett, I.M.,
O. Zatsepina,
L. Zamai,
L. Azzoni,
T. Mikheeva, and
B. Perussia.
1996.
Definition of a natural killer NKR-P1A+/CD56 /CD16 functionally immature human NK cell
subset that differentiates in vitro in the presence of interleukin
12.
J. Exp. Med.
184:
1845-1856
|
| 7. | Moore, T.A., M. Bennett, and V. Kumar. 1996. Murine natural killer cell differentiation: past, present, and future. Immunol. Res. 15: 151-162 [Medline]. |
| 8. |
Mrozek, E.,
P. Anderson, and
M.A. Caligiuri.
1996.
Role of
Interleukin-15 in the development of human CD56+ natural
killer cells from CD34+ hematopoietic progenitor cells.
Blood.
87:
2632-2640
|
| 9. |
Kündig, T.M.,
H. Schorle,
M.F. Bachmann,
H. Hengertner,
R.M. Zinkernagel, and
I. Horak.
1993.
Immune responses in
interleukin-2-deficient mice.
Science (Wash. DC).
262:
1059-1061
|
| 10. |
Giri, J.G.,
M. Ahdieh,
J. Eisenman,
K. Shanebeck,
K. Grabstein,
S. Kumaki,
A. Namen,
L.S. Park,
D. Cosman, and
D. Anderson.
1994.
Utilization of the and chains of the IL-2
receptor by the novel cytokine IL-15.
EMBO (Eur. Mol. Biol.
Organ.) J.
13:
2822-2830
[Medline].
|
| 11. |
Leclercq, G.,
V. Debacker,
M. De Smedt, and
J. Plum.
1996.
Differential effects of interleukin-15 and interleukin-2 on differentiation of bipotential T/natural killer progenitor cells.
J.
Exp. Med.
184:
325-336
|
| 12. | Puzanov, I.J., M. Bennett, and V. Kumar. 1996. IL-15 can substitute for the marrow microenvironment in the differentiation of natural killer cells. J. Immunol. 157: 4282-4285 [Abstract]. |
| 13. | Moore, T., M. Bennett, and V. Kumar. 1995. Transplantable NK cell progenitors in murine bone marrow. J. Immunol. 154: 1653-1663 [Abstract]. |
| 14. |
Moore, T.A., and
A. Zlotnik.
1995.
T-cell lineage commitment and cytokine responses of thymic progenitors.
Blood.
86:
1850-1860
|
| 15. | Moore, T.A., and A. Zlotnik. 1997. Differential effects of Flk-2/Flt-3 ligand and stem cell factor on murine thymic progenitor cells. J. Immunol. 158: 4187-4192 [Abstract]. |
| 16. | Attaya, M., S. Jameson, C.K. Martinez, E. Hermel, C. Aldrich, J. Forman, K.F. Lindahl, M.J. Bevan, and J.J. Monaco. 1992. Ham-2 corrects the class I antigen-processing defect in RMA-S cells. Nature (Lond.). 355: 647-649 [Medline]. |
| 17. | Yu, Y.Y.L., T. George, J.R. Dorfman, J. Roland, V. Kumar, and M. Bennett. 1996. The role of Ly49A and 5E6 (Ly49C) molecules in hybrid resistance mediated by murine natural killer cells against normal T cell blasts. Immunity. 4: 67-76 [Medline]. |
| 18. |
Giri, J.G.,
S. Kumaki,
M. Ahdieh,
D.J. Friend,
A. Loomis,
K. Shanebeck,
R. DuBose,
D. Cosman,
L.S. Park, and
D.M. Anderson.
1995.
Identification and cloning of a novel IL-15
binding protein that is structurally related to the chain of
the IL-2 receptor.
EMBO (Eur. Mol. Biol. Organ.) J.
14:
3654-3663
[Medline].
|
| 19. | Godfrey, D.I., M. Masciantonio, C.L. Tucek, M.A. Malin, R.L. Boyd, and P. Hugo. 1992. Thymic shared antigen-1. A novel thymocyte marker discriminating immature from mature thymocyte subsets. J. Immunol. 148: 2006-2011 [Abstract]. |
| 20. |
Antica, M.,
L. Wu,
K. Shortman, and
R. Scollay.
1994.
Thymic stem cells in mouse bone marrow.
Blood.
84:
111-117
|
| 21. | Georgopoulos, K., M. Bigby, J.H. Wang, A. Molnar, P. Wu, S. Winandy, and A. Sharpe. 1994. The Ikaros gene is required for the development of all lymphoid lineages. Cell. 79: 143-156 [Medline]. |
| 22. |
Sánchez, M.J.,
M.O. Muench,
M.G. Roncarolo,
L.L. Lanier, and
J.H. Phillips.
1994.
Identification of a common T/natural
killer cell progenitor in human fetal thymus.
J. Exp. Med.
180:
569-576
|
| 23. |
Wu, L.,
M. Antica,
G.R. Johnson,
R. Scollay, and
K. Shortman.
1991.
Developmental potential of the earliest precursor
cells from the adult mouse thymus.
J. Exp. Med.
174:
1617-1627
|
| 24. | Goldsmith, M.A., and W.C. Greene. 1994. Interleukin-2 and the interleukin-2 receptor. In The Cytokine Handbook. A.W. Thomson, editor. Academic Press Limited, San Diego. 57-80. |
| 25. |
Suzuki, H.,
G.S. Duncan,
H. Takimoto, and
T.W. Mak.
1997.
Abnormal development of intestinal intraepithelial lymphocytes and peripheral natural killer cells in mice lacking the IL-2
receptor chain.
J. Exp. Med.
185:
499-505
|
| 26. | Trinchieri, G.. 1989. Biology of natural killer cells. Adv. Immunol. 47: 187-376 [Medline]. |
| 27. | Garni-Wagner, B.A., A. Purohit, P.A. Mathew, M. Bennett, and V. Kumar. 1993. A novel function-associated molecule related to non-MHC-restricted cytotoxicity mediated by activated natural killer cells and T cells. J. Immunol. 151: 60-70 [Abstract]. |
| 28. | Wang, L.L., I.K. Mehta, P.A. LeBlanc, and W.M. Yokoyama. 1997. Mouse natural killer cells express gp49B1, a structural homologue of human killer inhibitory receptors. J. Immunol. 158: 13-17 [Abstract]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|