|
||
/
and
/
T Cells
Migrate from Thymus to the Periphery in Alternating Waves
By



From the * Centre National de la Recherche Scientifique Unitè de Recherche Associée 1135, Université
Pierre et Marie Curie, 75005 Paris, France;
Department of Medical Microbiology, Turku University,
FIN-20520 Turku, Finland; § Division of Developmental and Clinical Immunology, Departments of
Medicine, Pediatrics, and Microbiology, University of Alabama, and Howard Hughes Medical
Institute, Birmingham, Alabama 35294;
Basel Institute for Immunology, CH-4005 Basel,
Switzerland
The embryonic thymus is colonized by the influx of hemopoietic progenitors in waves. To
characterize the T cell progeny of the initial colonization waves, we used intravenous adoptive
transfer of bone marrow progenitors into congenic embryos. The experiments were performed
in birds because intravenous cell infusions can be performed more efficiently in avian than in
mammalian embryos. Progenitor cells, which entered the vascularized thymus via interlobular venules in the capsular region and capillaries located at the corticomedullary junction, homed
to the outer cortex to begin thymocyte differentiation. The kinetics of differentiation and emigration of the T cell progeny were analyzed for the first three waves of progenitors. Each progenitor wave gave rise to
/
T cells 3 d earlier than
/
T cells. Although the flow of T cell migration from the thymus was uninterrupted, distinct colonization and differentiation kinetics
defined three successive waves of
/
and
/
T cells that depart sequentially the thymus en
route to the periphery. Each wave of precursors rearranged all three TCR V
gene families,
but displayed a variable repertoire. The data indicate a complex pattern of repertoire diversification by the progeny of founder thymocyte progenitors.
Comparative developmental studies have been informative with regard to the evolution of the immune system in vertebrates. Studies in chickens have contributed to
the understanding of the hemopoietic stem cell origin of
both myeloid and lymphoid T and B cell lineages (1, 2).
This avian model has several advantages for the study of T
cell development: (a) T and B cells undergo differentiation
in specialized central lymphoid organs, T cells in the thymus, and B cells in the bursa of Fabricius, (b) a large number of precisely staged embryos can be easily obtained, and (c) the embryos are large enough for experimental manipulation. Studies performed in chick-quail chimeras indicate
an embryonic paraaortic origin of the stem cell precursors
of thymocytes, B cells, and myeloid cells, beginning around
the fourth day of embryonic life (E4;1 reference 3). Embryonic stem cells native to the aortic region later migrate via
the circulation to colonize the spleen, yolk sac, and, finally,
the bone marrow.
The chick-quail model has been used to show homing
of the thymocyte progenitors into the embryonic epithelial
thymus in three discrete waves (4), the first of which begins in chicken embryos on E6.5, the second on E12, and
the third around E18. Each wave of progenitor cell influx
lasts for 1 or 2 d, and is followed by the transient production of thymocyte progeny (7, 8). The first wave of thymus
colonization involves T cell progenitors from the paraaortic
region (7, 8), whereas the second and third waves of thymocyte progenitors come from the bone marrow and express the c-kit and the hematopoietic cell adhesion molecules (9, 10). Using congenic chicken strains that differ in
the ov alloantigen expressed on hematopoietic progenitors
and T lineage cells, H.B19ov+ and H.B19ov The ontogeny of chick T lineage cells can be monitored
with anti-TCR monoclonal antibodies and molecular probes
for the different TCR chains (14). At E12, ~ 5 d after
the initial influx of thymocyte precursors, a subpopulation
of thymocytes begins to express the TCR- Thymocyte transfer experiments in congenic chick
strains indicate that the TCR- Animals.
Embryonated eggs from the H.B19 strain of White
Leghorn chickens were produced at the Institute Chicken Facility
(Gipf-Oberfrick, Switzerland). Fertilized eggs were incubated at
38°C and 80% humidity in a ventilated incubator. The H.B19
strain was subdivided into two congenic lines, H.B19ov+ and
H.B19ov Immunolabeling.
The ov, TCR- Injection of Lymphoid Cells into Congenic Chickens.
Adoptive transfer between H.B19ov+ and H.B19ov
, we have examined chimeras created by grafting thymic lobes from an
ov+ donor into thymectomized ov
recipients to show the
gradual replacement of donor thymocytes by ov
host thymocytes and their progeny. These experiments indicated that a series of waves or stream of thymocyte progenitors
continually enter the thymus after hatching (11).
/
-CD3 complex on their surface (17). These reach peak numbers on
E15, when ~30% of the thymocytes express TCR-
/
(18). TCR-
/
-bearing T cells expressing the V
1 variable domain are first detected on thymocytes on E15, and
they become the predominant type of thymocytes by E17-18
(19). TCR-
/
-bearing T cells expressing the V
2 variable domain emerge around E18 (20). In chick-quail chimeras, the
/
and
/
(V
1 then V
2) T cell subpopulations were generated sequentially in the first wave, but not
in the second wave of thymocyte progenitors (8).
/
and (V
1)
/
thymocytes
generated by the different thymocyte progenitor waves
colonize the peripheral lymphoid organs in discrete waves
(11, 21). Examination of the TCR V
1 repertoire generated by each wave of thymocyte progenitors and expressed by their progeny in the thymus, spleen, and intestines indicates that all of the different V
1 gene segments
are expressed as early as E17. The thymic V
1-D
-J
repertoire expressed by each of the three waves of hemopoietic progenitors includes the same V
1 and J
elements,
and CDR3 created by the V
1-D
-J
junctions of similar lengths (13). The spleen is colonized both by V
1 and V
2
T cells, whereas it is difficult to find V
2 T cells in the intestine (13, 20).
genes have been identified recently in the
chicken. These include three V
families, three J
segments, and one C
region (15, 16). Although ontogenetic
studies in mice indicate that TCR-
gene rearrangement
proceeds in waves with
/
T cells expressing the different
V
gene segments are generated sequentially (22), pilot
studies in the chicken suggested that TCR-
rearrangement may not be so tightly regulated during avian development (16). In the present study, we have examined the potential of each wave of embryonic progenitors to produce
TCR-
/
and TCR-
/
(V
1) thymocytes by adoptive
transfer of hemopoietic progenitors into congenic embryos.
The ov alloantigen marker was used to purify the thymocyte progeny from the individual waves of progenitors colonizing the thymus. Repertoire analysis demonstrated
that although the precursors of each wave rearrange all
three TCR V
gene families, each wave may display differing V
and J
usage. The sequential differentiation of
/
and
/
T cells was a constant feature of all three developmental waves. Irrespective of the wave of progenitor colonization, the
/
T cell progeny differentiated about 3 d
faster than the
/
T cell progeny. Likewise, the migration of
/
and
/
T cells was found to occur to in an alternating fashion during each migration wave from the thymus to the periphery.
, distinguished by the ov antigen present on T lineage
cells in H.B19ov+ animals. The ov antigen, which is also expressed on bone marrow cells and a B cell subset, is recognized by
the 11-A-9 monoclonal antibody (9, 26, 27).
/
and TCR V
1 antigens
were detected by the 11-A-9, TCR1, and TCR2 mAbs, respectively (17, 19, 26, 28). 11-A-9 is a mouse IgM and TCR1 and
TCR2 are mouse IgG1 antibodies. Second step antibodies were
fluorescein labeled, sheep anti-mouse IgM and phycoerythrin- or
Texas red-coupled anti-mouse IgG1 antibodies (Southern Biotechnology Assoc., Birmingham, AL). Controls were performed
using the second step antibodies alone and regular staining of tissues from noninjected individuals of the H.B19ov
strain. Recent thymocyte emigrants, detected in blood by their FITC staining, were labeled by phycoerythrin-coupled TCR1 or TCR2 antibodies (Southern Biotechnology Assoc.). Frozen sections of embryonic organs were cut to a thickness of 5 µm on a cryostat (Bright, Hunkingdom, UK), fixed with acetone, and rehydrated
in PBS containing 1% BSA.
strains could be performed
without complications since these strains do not differ at major
histocompatibility antigens and T cell alloreactivity against a different ov antigenic determinant has not been observed in mixed
lymphocyte reaction and graft versus host reactions. Bone marrow cells (2.0 × 107) from donor H.B19ov+ embryos were injected into a large vein near the airsac of recipient H.B19ov
embryos (29). These experiments were performed with E13 and E18
age-matched donor and recipient embryos. Control injections of
sorted TCR-positive populations of E18 bone marrow cells were performed to determine that differentiated bone marrow lymphocytes were not able to colonize the thymus in this assay. For that
purpose, bone marrow cells from 18-d-old H.B19ov+ embryos
were suspended in PBS containing 10% FCS, filtered through a
nylon sieve (mesh width of 25 µm; Nytal P-25 my; SST, Thal, Switzerland) and centrifuged at 225 g for 7 min. Immunofluorescence staining was performed in 96-well plates, to avoid repeated
centrifugation using either the anti-TCR-
/
antibody TCR1
or the anti-TCR V
1 antibody TCR2 and then fluorescein-coupled anti-mouse Ig antibody (Silenus, Hawthorn, Australia). Stained
and unstained bone marrow cells were resuspended in 10% FCS/
PBS and sorted using a FACSTAR Plus® cell sorter (Becton
Dickinson, Mountain View, CA). None of the recipients received irradiation or other immunosuppressive treatment. Donor
ov+ cells in the thymus were analyzed by flow cytometry and by
two-color immunofluorescence staining of frozen tissue sections.
For analysis by FACScan®, single thymocyte suspensions were made
by physical disruption in PBS and filtration through a nylon sieve.
repertoires specifically generated by
E13 and E18 bone marrow precursors,
/
thymocytes of the donor type were sorted 9 d after injection of the precursors. Thymocytes were submitted to a two-color immunofluorescence staining using the anti-TCR-
/
antibody TCR1 and the anti-ov antibody
11-A-9 and then FITC-coupled anti-mouse IgM and phycoerythrin-coupled anti-mouse IgG1 antibodies (Southern Biotechnology
Assoc.). The cells were sorted using a FACSTAR Plus® cell sorter.
Analysis of Recent Thymocyte Emigrants. Emigration of the thymocytes into the circulation was examined after in situ FITC labeling of thymocytes. Young chicks were anesthesized by intramuscular injection of 0.4 ml ketamin solution (Imalgene 500; Rhone Mérieux, Lyon, France; diluted 1:10 in PBS) followed by a short inhalation of Halothane (Hoechst, Frankfurt, Germany). The skin of the neck region was opened with scissors and each thymus lobe was injected with 10 µl of an FITC solution at 1 mM in DMSO. The skin was then closed using tissue clamps (Autoclip; Clay Adams, Becton Dickinson Primary Care, Sparks, MD) and the chickens were kept warm under an infrared lamp until they were fully conscious. Chickens were bled 12 h after injection and FITC-labeled lymphocytes were analyzed by flow cytometry.
cDNA Synthesis. Total cellular RNA from thymus was isolated using the guanidium isothiocyanate method (30). About 5 µg was used as template for the synthesis of randomly primed single-stranded cDNA using mouse mammary leukemia virus reverse transcriptase (Life Technologies, Inc., Gaithersburg, MD) in a reaction volume of 20 µl according to the supplier's instructions. This cDNA was subsequently diluted to 100 µl with water and heated to 94°C for 2 min to inactivate the mouse leukemia virus reverse transcriptase.
PCR and Semiquantitative PCR of V
Transcripts.
A PCR technique was used to amplify the TCR-
transcripts. Transcripts deriving from rearranged TCR V
1, V
2, and V
3 genes were amplified independently using oligonucleotide primers specifics for each
V
family and a primer located in the C
region. Oligonucleotide primers CKVG1UP2, CKVG2UP3, and CKVG3UP1 were specific
for the V
1, V
2, and V
3 regions, respectively. The CKCG1DO1
oligonucleotide primer was located 230 nucleotides downstream
the 5
end of the C
region. The procedures used for semiquantitative PCR followed the detailed description given by Keller et
al. (31). The amount of cDNA synthesized was calibrated by using
the relative expression level of
actin as a standard. The two actin
oligonucleotide primers, 4611 and 4612, generated a band of 283 and
648 bp on cDNA and genomic DNA respectively (32). The following are CKVG1UP2 (V
1 region): GCTACCAGAGAGAGATCC; CKVG2UP3 (V
2 region): CATACAGAGCCCTGTATC; CKVG3UP1 (V
3 region): GATACTGTACATGTCTGG;
CKCG1DO1 (C
region, antisense): GACTCGAGCTCTCCAGTGGTACAGATAAC; CGAMMA1DD (5
of C
, antisense): TTTCATGTTCCTCCTGC; 4611 (5
of actin, from
nucleotide 2057, see reference 32): TACCACAATGTACCCTGGC; 4612 (3
of actin, from nucleotide 2704, antisense, see
reference 32): CTCGTCTTGTTTTATGCGC.
mercaptoethanol. Reaction mixtures were denatured by heating to
96°C for 5 min, and then subjected to 32 rounds of amplification
using a Biometra Trio-thermoblock thermocycler under the following conditions: 96°C for 15 s, 50°C for 40 s, and 72°C for 1 min for
cDNA amplification. Final extension was done at 72°C for 10 min.
Cloning and Sequencing of TCR-
Transcripts.
The TCR-
V-J-C
regions were specifically amplified by PCR. Amplified DNA
fragments were gel purified and cloned into pCRTMII vector (Invitrogen, San Diego, CA). Sequences were determined from denatured double-stranded recombinant plasmid DNA (33) using
SequenaseTM (Amersham Corp., Arlington Heights, IL) in the
chain termination reaction (34) and the oligonucleotide primer
CGAMMA1DD starting 60 nucleotides downstream the 5
end
of C
segment in the antisense orientation. In a number of cases
where ambiguities remained, several additional nucleotide primers were used. Sequences were analyzed and assembled with the
software package of the CITI2 (Paris, France). TCR-
cDNA sequences have been submitted to the EMBL/GenBank/DDBJ database under accession numbers z97216 to z97332.
The initial wave of progenitor colonization and
thymocyte differentiation can be examined in situ in unmanipulated animals. However, analysis of members of the
succeeding waves requires a discriminating strategy. Embryonic hemopoietic precursors express the ov antigen in
H.B19ov+ birds, and the antigen is maintained on T lineage cells and a subset of B cells. This expression pattern allowed us to examine successive waves of the ov+ progenitor populations in the embryonic thymus and the fate of their T cell progeny in ov
congenic recipients. To examine the second wave of thymus colonization by progenitor
cells, E13 bone marrow cells of the ov+ strain were injected into E13 chicken embryos of the congenic H.B19ov
strain, and the thymocyte progenitor influx, migration, and differentiation patterns were examined in thymus sections by immunohistochemistry. By E16, donor
cells of bone marrow origin accumulated in the thymic blood vessels, both in interlobular venules and in capillaries located at the corticomedullary junction (Fig. 1); relatively few donor cells were found in the parenchyma of the thymus at this time. E19 ov+ cell invasion and accumulation
within the thymic cortex was evident, but by E20 the donor cells had relocated to occupy the outermost cortex of
the thymic lobules. This ontogenetic pattern suggests that
thymocyte progenitors entering the embryonic thymus either via the corticomedullary junction or the capsular subsequently make their way to the outer cortex of the thymus
(Fig.1 C). The donor cells were later found throughout the
cortex and by day 23, mature ov+ donor T cells had begun
to accumulate in the medulla. This complex intrathymic
pattern of migration appears specific to bone marrow- derived thymocyte progenitors, since mature thymocytes
and T cells failed to home to the thymus in other adoptive
transfer experiments (not shown).
embryos injected with donor E13 H.B19ov+ bone
marrow cells were examined by differential immunofluorescence staining at E16, E19, E20, and E23. Donor ov+ progenitors are labeled with fluorescein;
TCR-
/
and TCR-
/
-positive cells are labeled with Texas red. Original magnifications: (A) 270, (B) 170. Scale bars correspond to 100 µm. (C) Diagrammatic representation of chicken T cell progenitor migration pathways in the thymus. At E16, T cell progenitors were located either in capillaries at
the cortico-medullary junction (a) or close to the thymic capsule (b). Donor cells originally located at the corticomedullary junction or at the capsule were
found later (E19) in the cortex, and by E20 had reached the outer cortex. By E23 (2 d after hatching), some donor cells were found in the medulla where
they expressed TCR-
/
(V
1) or TCR-
/
(d). The first TCR-
+ donor cells were found on E19-20. c, cortex; m, medulla.
Intrathymic Differentiation Kinetics Are Consistently Accelerated for the
/
T Cell Subpopulation.
The appearance of
/
T cells precedes that of V
1
/
cells by a period of
~3 d during the initial wave of thymocyte development (18), but studies in chick-quail chimeras suggest this may
be a one time occurrence (8). In our studies of the second
wave of thymocyte differentiation, the injection of E13
H.B19ov+ bone marrow cells into E13 H.B19ov
embryos
led to the appearance of donor
/
+ thymocytes 5 d later
and donor
/
thymocytes ~8 d later (Figs. 2 and 3 A).
The proportion of ov+ donor thymocytes expressing
TCR-
/
peaked at 40% on day 21. The first donor
/
(V
1+) thymocytes were detected on E20 and these
reached a peak level of 57% on E26 (Fig. 3 A). When the
third wave of thymocyte differentiation was examined by
injection of E18 ov+ bone marrow cells into E18 ov
recipients, the same rule held true;
/
T cells appeared 4 d before the
/
T cells (Fig. 3 B). Interestingly, for the cell transfer experiments performed during the second wave of
precursor colonization, the level of chimerism was relatively greater for
/
than for
/
T cells (Fig. 3 C). However, taking into account the proliferation kinetics for the
progeny of each precursor wave, the TCR-
/
thymocyte
progeny appeared to be 12 to 16 times less numerous than
the TCR-
/
(V
1) thymocyte progeny (Fig. 3 D, and data not shown). The levels of donor
/
and
/
thymocytes peaked at days 23 and 26, respectively, corresponding to the main period of second wave emigration to
the periphery. The differential chimerism of
/
and
/
T cells thus may reflect the differential emigration kinetics
of
/
and
/
T cells.
embryos, the donor cells were examined
for T cell expression as a function of developmental age. Thymocytes of
recipients were analyzed by immunofluorescence flow cytometry: ov,
TCR-
/
and ov, and TCR V
1. Each dot plot presents 50,000 events
for the gated thymocyte population. Hatching occurs at E21.
/
+ and TCR-
/
(V
1)+ T cell progeny. (A and B) Proportion of thymocytes expressing TCR-
/
or TCR-
/
(V
1) among donor ov+ thymocytes was determined by immunofluorescence flow cytometry. Each point corresponds
to the mean value for three to five animals in four independent experiments. The differentiation of second wave T cell progenitors was analyzed by adoptive transfer of E13 H.B19ov+ bone marrow into E13
H.B19ov
embryos, and for analysis of the third wave, E18 H.B19ov+
bone marrow cells were injected into E18 H.B19ov
embryos (injections
of 2.0 × 107 cells). (C) Proportions of donor ov+ thymocytes that express
TCR-
/
or TCR-
/
(V
1) during the differentiation of the second
wave of progenitors. (D) Proportions of donor ov+ TCR-
/
+ and ov+
TCR-
/
(V
1)+ thymocytes derived from second wave thymocyte
progenitors among the total thymocyte population in the recipient. The
realistic efficiency of the
/
and V
1 T cell differentiation pathways followed by the progeny of the second wave of thymocyte progenitors can
be estimated, since the areas under these curves are roughly proportional
to the numbers of
/
and V
1 thymocytes produced by the donor second wave progenitors. This assessment suggests that the donor progenitors produced >15 times more
/
(V
1) than
/
thymocytes.
Mature
/
and
/
Thymocytes Migrate to the Periphery in
Alternating Waves.
The colonization of the thymus in discrete waves (7, 8), and the differences in differentiation and
emigration kinetics of
/
and
/
thymocytes suggest interspersed emigration of the mature
/
and
/
thymocyte subsets (11). To test this hypothesis, we examined the phenotype of recent thymocyte migrants at
different developmental ages. In these experiments, thymocytes of chicks at 21 (hatching)-30 d were labeled in
situ by intrathymic injection of FITC. Blood samples were
obtained 12 h later and labeled lymphocytes in the circulation were analyzed for expression of TCR-
/
or TCR-
/
(V
1) (Fig. 4). The FITC-labeled cells represented
3-10% of the peripheral blood lymphocytes. Approximately 75% of these were
/
or
/
(V
1+) T cells; of
the remaining 25% approximately half were
/
(V
2+) T
cells and the rest were TCR
. Peaks of recent
/
thymocyte emigrants were detected on days 21-23 and 27-28,
and a peak of recent
/
thymocyte emigrants was observed on days 24-26. The frequency of FITC-labeled
/
thymocyte emigrants reached a maximum of 20%, whereas
the peak of labeled V
1 emigrants reached a maximum of
70%. These figures reflected the fact that each precursor
wave gives rise to ~5%
/
and 75%
/
(V
1+) thymocytes, respectively. Thymocyte progenitors in each colonization period thus gave rise to
/
T cell progeny
within 9 d and
/
(V
1+) T cell progeny within 12 d,
and these migrated in the same sequence to the periphery.
Since each colonization period is followed by a refractory
interval of ~4 d, the end result is alternating emigrant waves of
/
and
/
(V
1) T cells, with minimal overlap
of migrant cells representing each of the three embryonic
waves of thymocyte progenitors.
/
or TCR-
/
(V
1) were detected by phycoerythrin-coupled antibodies. Results are expressed in percent of
fluorescein-labeled cells expressing either TCR-
/
and TCR-
/
V
1 cells, and each point
corresponds to the mean value
for four recipients. Hatched areas indicate the peak periods of splenic and
intestinal colonization by
/
and
/
(V
1) T cells derived from the
thymus (13, 21).
Each Thymocyte Progenitor Wave Contributes a Characteristic TCR-
Repertoire.
The TCR-
repertoire expressed by
the thymocyte progeny of each progenitor wave was addressed in these experiments. Simple sorting of E13 thymocytes reactive with the anti-TCR-
/
antibody was
sufficient to isolate first wave progeny for repertoire analysis. Since the progeny of successive waves may accumulate
in the thymus during development, isolation of the second
and the third wave progeny required the more complex
strategy of adoptive transfer between the H.B19ov+/
congenic chicken strains. The progeny of second wave progenitors was isolated after the injection of E13 bone marrow cells from H.B19ov+ donors into age-matched
H.B19ov
recipients. The ov+ TCR-
/
+ thymocytes
(14,000 cells) were then sampled on day 22. To purify the
progeny of the third progenitor wave, a similar adoptive
transfer was made into E18 embryos, and ov+ TCR-
/
+
thymocytes in the recipients were sorted (1,400 cells) on
day 28.
To examine the TCR-
repertoire expressed in each developmental wave of thymocytes, we performed a PCR
using a 3
primer specific for C
and 5
primers specific for
V
1, V
2, or V
3 segments. First, we determined that
V
1-J
-C
, V
2-J
-C
, and V
3-J
-C
transcripts were
present as early as E10-11 in ov+ embryos, confirming in
this congenic strain that the three different V
subfamilies
undergo rearrangment simultaneously (Fig. 5 A). A similar
analysis of the second and third wave progeny indicated that all three V
gene subfamilies also undergo rearrangement in these waves (Fig. 5 B). However, the V
subfamily
representation differed among three waves. The TCR-
repertoire of the second wave was composed mainly of
V
2 transcripts, whereas transcripts containing the V
1 and
V
3 gene segments were weakly represented. In contrast,
V
1, V
2, and V
3 transcripts appeared to be equally well
represented in the first and the third waves of thymus colonization (Fig. 5 B).
transcripts. Identification of V
1-J
-C
, V
2-J
-C
, and V
3-J
-C
transcripts by PCR amplification. Actin expression was
used to standardize cDNA
amounts and to allow semiquantitative analysis. Templates were
cDNA from thymus at various
stages of development. After 32 cycles of amplification, PCR
products were electrophoresed,
stained with ethidiumbromide,
and photographed. (A) Ontogeny of the different V
transcripts in chicken embryos. (B)
Comparative analysis of the different V
transcripts in the three
developmental waves of thymocytes. Thymocytes derived
from the first, second, and third
wave of precursors were from
E13 embryos, 1-d-old chicks
(day 22), and 1-wk-old chicks
(day 28), respectively. First, second, and third wave thymocytes were obtained from multiple embryos.
A more detailed analysis of the representative TCR-
repertoires was performed by cloning of the PCR products
and sequencing ~30 clones for each V
gene subfamily/
thymocyte wave (Figs. 6 and 7). In the H.B19ov+ chicken
strain, six V
1, 12 V
2, and 10 V
3 members were detected. The V
2 subfamily was divided into eight V
2a
members, three V
2b members, and a new member, V
2c,
that differs significantly from the V
2a and V
2b subfamilies. In contrast to the differences in V
subfamily usage
(Fig. 5 B), significant differences were not seen in the representation of members within a given V
subfamily for
the three thymocyte waves (Fig. 7). Different members of
the three V
families were found to rearrange with all three
different J
segments. However, preferential pairings of V
and J
segments were observed. In each of developmental
waves, V
2 segments were rearranged with J
2 segments
(Table 1). In addition, variable J
usage patterns were seen
in V
1- and V
3- containing transcripts for the three thymocyte waves. A high frequency of V
1/J
2 rearrangements in the first thymocyte wave was rearranged with the
J
1 segment in the first wave and with the J
3 segment in
the following waves.
segments observed in the H.B19ov+ chicken
strain. Comparison of COOH-terminal amino acid sequences of the V
1,
V
2, and V
3 subfamily members identified for the H.B19ov+ chicken
strain by sequence analysis of PCR-derived cDNAs. Residues identical to
the prototypic sequence are represented by dashes. V
segments are numbered according to Six et al. (16). §, V
1.1 and V
3.1 segment references
were not encountered in our study; = new V
members. Some members
differ by several nucleotides, but code for the same amino acid sequence.
The V
2b2 member presents a stop codon (*) and might correspond to a
pseudogene.
repertoires comparison for the three developmental
waves of thymocyte precursors. Nucleotide sequences are shown for the
V
-J
junctions. V
members, J
members, and the number of sequenced clones are indicated. The in frame clones are indicated by +. Assignment of nucleotides to the V
, J
1, and J
2 segments is based on germline sequences. J
3 region assignment is based on a consensus sequence
from a TCR-
cDNA clone containing the J
3 segment. Nucleotides
that cannot be assigned to either V
or J
gene segments are indicated as
nontemplate/palindromic additions. Putative P (palindromic) nucleotides
are underlined. Thymocytes derived from the first, second, and third
wave of precursors correspond to thymocytes from embryos (day 13),
1-d-old chicks (day 22), and 1-wk-old chicks (day 28), respectively. (A)
TCR V
1 repertoires, (B) TCR V
2 repertoires, and (C) TCR V
3 repertoires.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
A striking feature of the TCR-
transcript analysis was
the occurrence of recurrent clones exhibiting the same V
-
J
junction in the second and third thymocyte waves (Fig.
7). (a) 30 identical V
1-J
1-C
clones (2v12) were found
in the second thymocyte wave and 9 such clones (3v14)
were found in the third thymocyte wave. (b) 19 identical
V
3-J
3-C
clones were found in the second wave (2v32), and 7 clones of this type (3v32) were encountered
in the third thymocyte wave. Thus, the low frequency of
V
1 and V
3 subfamily usage in the second thymocyte
wave was associated with an increased representation of repetitive clones.
Differences in CDR3 length were not observed in the
repertoires generated by the three embryonic waves. However, an apparent increase in N/P nucleotide insertions at
the V
-J
junction suggested an increase in CDR3 diversity in the third thymocyte wave (Table 2).
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Three discrete waves of thymocyte progenitors enter the
embryonic chick thymus to generate three successive waves
of T cell progeny members which leave the thymus to colonize peripheral organs such as the spleen and the intestine.
The present studies indicate that each wave of progenitors
gives rise first to
/
thymocytes and then
/
(V
1) thymocytes 3 or 4 d later so that the
/
and
/
(V
1) T
cells migrate asynchronously from the thymus. Progenitor
colonization of the thymus in waves and an accelerated rate
of
/
T cell differentiation thus contribute to the alternating emigration of first
/
and then
/
T cells to the periphery (Fig. 8). Analysis of the TCR-
repertoire for the
different thymocyte waves suggests that they differ in V
and J
usage as well as in CDR3 diversity.
/
T cells in ~9 d, and mature
/
T cells in 12 d. Thymocyte emigration analysis, in agreement
with the peaks of emigration period of thymocytes to the spleen and intestine reported previously (11), reveals that
/
and
/
T cells emigrate from thymus to periphery in alternating waves.
Thymus colonization by waves of hemopoietic progenitors also appears to occur in mammals (35, 36), but can be examined in greater detail in the chicken because of embryo accessibility and the opportunity to purify the progeny of individual waves of progenitors. Adoptive transfer of alloantigen-marked progenitors allowed us to elucidate the homing routes whereby these enter the embryonic thymus. This analysis indicates that progenitors of bone marrow origin enter the thymus either via interlobular venules or capillaries located at the corticomedullary junction. Both routes have been described in the mouse, but were not shown to be used simultaneously, the transcapsule route thought to be restricted to thymus colonization before its vascularization (37, 38). In the congenic chick chimeras, progenitors entering at the corticomedullary junction subsequently migrated to the outer cortex of the thymus, where precursors entering through the capsule were also found. This outer cortical homing pattern of thymocyte precursors has also been noted after direct needle injection in mice. As has been described in mammals (37), thymocytes then migrate from the outer cortex as they undergo T cell differentiation en route to the thymic medulla.
An interesting question concerns whether each embryonic wave of precursors generates the same or different T
cell repertoires. Studies of the TCR-
repertoire generated
during mouse development indicate sequential usage of V
genes. The first
/
T cells generated during embryonic
development express V
5-C
1 transcripts, the second
population of
/
T cells express V
6-C
1 transcripts, and
/
T cells become more heterogeneous for V
usage after
birth (22, 25). In similar fashion, the V
1 gene segments
are rearranged before the V
2 gene segments during avian
ontogeny (39). However, the V
gene families do not undergo sequential rearrangement during ontogeny. The
chicken TCR-
locus consists of 3 V
families with ~10
members each, 3 J
segments, and 1 C
segments (15, 16). The first wave of thymocyte progeny rearrange all three
V
families and J
genes as early as E10-E11. This type of
unrestricted TCR-
rearrangement pattern has also been
suggested in sheep and humans (40, 41). On the other
hand, preferential V
J
pairings were observed for the
three developmental waves of thymocytes, whereas preferred TCR V
1/D/J
rearrangements were not apparent
during ontogeny (13). The V
J
junctional variations
(CDR3) for all three embryonic thymocyte waves were
more limited than in the adult (16). Such differences between embryonic and adult repertoires have also been
found in mammals (42). Finally, the nonproductively rearranged TCR-
transcripts observed in TCR-
/
+ov+ thymocytes indicate that V
J
rearrangements occur on both
alleles in avian
/
T cells.
A high frequency of repetitive TCR-
transcripts was
found in the second and third waves of thymocyte progeny, particularly in the second wave of thymocytes where
two clones, 2v12 and 2v32, represented 97 and 66% of the
V
1 and V
3 repertoires, respectively. This result could
represent a PCR artefact or a sampling error due to the
limited numbers of cells being analyzed. However, several observations suggest that the TCR-
repertoire may differ
for the different waves. (a) The V
1 and V
3 repertoire diversities were higher in the third wave than in second, even
though the number of
/
+ donor-derived thymocytes
examined in the second wave was ten times higher than for
the third wave (14 × 103 versus 1.4 × 103
/
cells). (b)
Repetitious clones were also encountered in the third wave
repertoire, albeit at lower frequencies (31% for 2v12-3v14, 23% for 2v32-3v32). (c) The cDNA synthesis, PCR amplification, and product cloning procedures were repeated
three times to confirm the findings. (d) Repetitive transcripts were not encountered in the V
2 repertoire preferentially used by the second thymocyte wave. Thus, the
high frequency of repetitive invariant clones in V
1 and
V
3 repertoires created by cells of the second wave is in
agreement with a lower usage of V
1 and V
3 families in this wave.
Differences in the TCR-
repertoire generated in each
progenitor wave could reflect differences in the colonizing
progenitors. The first wave of thymocyte progenitor are
derived from multipotent hematopoietic stem cells that
arose in the paraaortic region of the embryo (3), whereas
the second and third wave of thymocyte progenitors were
derived from the bone marrow. The generation of different
TCR-
repertoires could therefore reflect differences in
the progenitor cells themselves. The differentiation kinetics of
/
and
/
(V
1+) thymocytes were conserved for the
three developmental waves of thymocyte progenitors. The
times required for differentiation of
/
and
/
(V
1)
thymocytes were ~9 and 12 d, respectively, in the chicken.
The accelerated differentiation of avian
/
versus
/
thymocytes has also been noted for mouse thymocyte precursors (43, 44). Different selection processes for the
/
and
the
/
thymocytes may contribute to the differences in
differentiation kinetics (45, 46). Different growth requirements during
/
and
/
T cell differentiation, such as
IL-7 requirement, may also promote different differentiation kinetics (47).
The thymocyte emigration model whereby peripheral
tissues are colonized by
/
T cells before
/
(V
1+) T
cells may favor harmonious development of a strategic immune defense system mediated by interacting lymphocyte
subpopulations. The interaction of
/
T cells with cells in
the peripheral organs could provoke microenvironmental
modification that favors the homing of
/
T cells. The
location of
/
and
/
T cells in peripheral tissues may
play an important role in the establishment of an immune
response, in that recent evidence suggests
/
T cells may
function as regulatory cells for
/
T cells (48). During
organogenesis, new niches for lymphocyte homing may
appear throughout development. The interspersed emigration of
/
and V
1 thymocytes might provide a mechanism to fill these niches by
/
and
/
cells in developing
organs. The observed interspersed emigration of
/
and
/
(V
1+) thymocytes could also affect the homing patterns of specific thymocyte subpopulations. For example,
two thymocyte subpopulations are emigrating from the
thymus at day 21-23, the
/
thymocytes generated by the
second wave of precursors and the minor second subpopulation of
/
(Vb2+) T cells generated by the first wave of
progenitors (8). Interestingly,
/
thymocytes colonize the
intestine in massive numbers, whereas V
2 thymocytes are
rarely seen in that organ (20). These two populations may
compete for homing sites, thus diverting the V
2 population to other organs. Since an optimal immune response
may require collaboration between
/
and
/
T cells,
sequential migration of
/
and
/
thymocyte subpopulations may provide an efficient means to maintain a physiological balance between the two cell populations during
development.
Address correspondence to Pr. D. Dunon, UPMC, CNRS URA 1135, Equipe Adhésion et Migration Cellulaires, Bâtiment C-30, Boîte 25, 7eme étage, 9, Quai Saint-Bernard, 75252 Paris Cedex 05, France. Phone: 33-1-44-27-35-00; FAX: 33-1-44-27-34-97; E-mail: dunon{at}ccr.jussieu.fr. The present address of B.A. Imhof is Centre Medical Universitaire, Department of Pathology, CH-1211 Geneva, Switzerland.
Received for publication 25 March 1997 and in revised form 27 June 1997.
The authors thank Mark Dessing, Victor Hasler, Barbara Ecabert, and Birgit Kugelberg for excellent technical assitance; Jean Desrosiers, Hans Spalinger, and Beatrice Pfeiffer for photography; and Drs. Klaus Karjalainen, Hans Reimer Rodewald, and Charley Steinberg for critical reading and improvement of the manuscript.
This work was supported by the Association pour la Recherche contre le Cancer, Association pour la Recherche contre le Cancer (ARC), the Human Frontier Science Programme Organization, Human Fronten Science Programme Organisation (HFSP), and the Academy of Finland. The Basel Institute for Immunology was founded and is supported by F. Hoffmann-La Roche (Basel, Switzerland).
| 1. | Cooper, M., D. Peterson, and R. Good. 1965. Delineation of the thymic and bursal lymphoid system in the chicken. Nature (Lond.). 205: 143-146 [Medline]. |
| 2. | Moore, M.A.S., and J.J.T. Owen. 1967. Experimental studies on the development of the thymus. J. Exp. Med. 126: 715-726 [Abstract]. |
| 3. | Dieterlen-Lièvre, F., I. Godin, and L. Pardanaud. 1996. Ontogeny of hematopoiesis in the avian embryo: a general paradigm. Curr. Top. Microbiol. Immunol. 212: 119-128 [Medline]. |
| 4. | Jotereau, F.V., E. Houssaint, and N.M. Le Douarin. 1980. Lymphoid stem cell homing to the early thymic primordium of the avian embryo. Eur. J. Immunol. 10: 620-627 [Medline]. |
| 5. | Jotereau, F.V., and N.M. Le Douarin. 1982. Demonstration of a cyclic renewal of the lymphocyte precursor cells in the quail thymus during embryonic and perinatal life. J. Immunol. 129: 1869-1877 [Medline]. |
| 6. | Le Douarin, N.M., F.V. Jotereau, E. Houssaint, and J.P. Thiery. 1984. Primary lymphoid organ ontogeny in birds. In Chimeras in Developmental Biology. N.M. Le Douarin and A. McLaren, editors. Academic Press, London. 179-216. |
| 7. | Coltey, M., F.V. Jotereau, and N.M. Le Douarin. 1987. Evidence for a cyclic renewal of lymphocyte precursor cells in the embryonic chick thymus. Cell Differ. 22: 71-82 [Medline]. |
| 8. |
Coltey, M.,
R.P. Bucy,
C.H. Chen,
J. Cihak,
U. Lösch,
D. Char,
N.M. Le Douarin, and
M.D. Cooper.
1989.
Analysis
of the first two waves of thymus homing stem cells and their
T cell progeny in chick-quail chimeras.
J. Exp. Med.
170:
543-557
|
| 9. |
Dunon, D.,
J. Kaufman,
J. Salomonsen,
K. Skjoedt,
O. Vainio,
J.P. Thiery, and
B.A. Imhof.
1990.
T cell precursor
migration towards 2-microglobulin is involved in thymus
colonization of chicken embryos.
EMBO (Eur. Mol. Biol. Organ.) J.
9:
3315-3322
[Medline].
|
| 10. |
Vainio, O.,
D. Dunon,
F. Aïssi,
J.P. Dangy,
K.M. McNagny, and
B.A. Imhof.
1996.
HEMCAM, an adhesion molecule
expressed by c-kit+ hemopoietic progenitors.
J. Cell Biol.
135:
1655-1668
|
| 11. |
Dunon, D.,
M. Cooper, and
B. Imhof.
1993.
Thymic origin
of embryonic intestinal / T cells.
J. Exp. Med.
177:
257-263
|
| 12. | Dunon, D., M.D. Cooper, and B.A. I |