|
||
Chemokine, Interleukin 8, Inhibits the Antiviral
Action of Interferon
By


From the * Department of Biological and Medical Research, King Faisal Specialist Hospital & Research Center, Riyadh, Saudi Arabia 11211;
Department of Microbiology, Kanazawa Medical
University, Ishikawa 920-0; § Department of Pharmacology, Kanazwa University, Kanazawa 920;
and
Department of Molecular Preventive Medicine, University of Tokyo, Tokyo 113, Japan
Interferon (IFN) exhibits a potent antiviral activity in vitro and plays a major role in the early
defense against viruses. Like IFN, the proinflammatory chemokine, interleukin (IL)-8, is induced by viruses and appears in circulation during viral infections. In an in vitro cytopathic effect assay for IFN, we found that IL-8 can inhibit IFN-
activity in a dose-dependent manner.
This action was reversed by specific monoclonal antibodies to IL-8. The chemokine was able
to attenuate the IFN-mediated inhibition of viral replication as determined by measuring infectious virus yield. IL-8 also diminished the ability of IFN to inhibit an early stage of viral replication since IL-8 attenuated the inhibition of the formation of viral proteins. It appeared that
IL-8 interfered with a late rather than an early step of IFN-mediated pathway such as early
gene expression. The IL-8 inhibitory action on IFN-
antiviral activity was associated with reduced 2
,5
-A oligoadenylate synthetase activity, a pathway well correlative with the anti- encephalomyocarditis virus action of IFN-
. Understanding pathways that antagonize IFN action may lead to novel approaches to potentiate endogenous and therapeutic IFN.
IFNs are induced in many cell types in response to viruses
and possess their known antiviral activity against a variety
of DNA and RNA viruses (1, 2). Because of its unique antiproliferative and antiviral properties, IFN- We previously reported that IL-8, a chemotactic protein,
is induced by cytomegalovirus (CMV)1 in the monocytic
THP-1 cell line (3) and that IL-8 enhances the replication
of several viruses including CMV (4), encephalomyocarditis virus (EMCV), and poliovirus (5). Others showed that
viruses such as respiratory influenza virus, syncytial virus,
and rotavirus induced IL-8 production (6). These observations prompted us to investigate the possibility that IL-8
may inhibit the antiviral action of IFN- IL-8 is the best characterized member of the family of
chemokines: proinflammatory cytokines that chemoattract
and activate blood cells (9, 10). This protein belongs to the
subfamily of Cells and Viruses.
The human epithelial amnion WISH cell
line (HeLa markers) was obtained from Dr. J.A. Armstrong (University of Pittsburgh, Pittsburgh, PA). Normal human fibroblasts
were prepared from foreskin. VERO (African green monkey kidney), L929 (mouse fibrosarcoma), THP-1 (human monocytic), and
MRC-5 (human fibroblastic lung) cell lines were obtained from
the American Type Culture Collection (Rockville, MD). All cell
lines were grown at 37°C and 5% CO2 in MEM (GIBCO BRL,
Gaithersburg, MD) supplemented with 10% newborn calf serum
(GIBCO BRL), except for THP-1 cells which were grown in
RPMI 1640 with 10% fetal bovine serum (FBS).
is being used
as a therapeutic agent in a number of infectious and noninfectious diseases, and in several clinical trials. Thus, the elucidation of mechanisms that may either synergize or antagonize IFN-
antiviral action may lead to ways to maximize
endogenous and exogenous IFN benefits.
.
chemokines (CXC family), which are distinguished from
chemokines (CC family) by few structural and functional dissimilarities. Besides its central role in
inflammation, other biological functions of IL-8 include T
cell chemotaxis (11), angiogenesis (12), and hematopoiesis
(13). In this paper, we report a novel function for the
chemokine, IL-8, which is inhibition of the antiviral action
of IFN-
.
70°C until use.
IFNs and IL-8.
Human rIL-8 was expressed in Escherichia coli
as previously described (14). Biological activity was assessed using
neutrophil chemotaxis multiwell Boyden chamber assay as described (15); maximum activity was observed at 10 ng/ml (15).
Also, rIL-8 (Lot No. BA-044041; R&D Systems, Minneapolis,
MN) was occasionally used and similar results were obtained. When
both rIL-8 were calibrated against the reference preparation 89/
520 (National Institute for Biologicals Standardization and Calibration, Hertfordshire, UK), the maximum activity was in the
vicinity of 100 IU/ml. Human rIFN-
2a, obtained from Hoffman-LaRoche (Basel, Switzerland), had a specific activity of 2 × 108 IU/mg, as reported by the manufacturer. A starting solution
was made and calibrated with NIH Gxa01-901-535 IFN-
reference preparation; the titer was 109 IU/ml. rIFN-
was obtained
from Genzyme (Cambridge, MA) and had a specific activity of 107
U/mg, according to the manufacturer. A starting solution was made and calibrated with NIH Gxg01-901-535 reference preparation; the titer was 106 IU/ml.
IFN Bioassay.
The tetrazolium salt (MTS) IFN microtiter assay was used to assess potency of IFN-
by measuring end point titers. The assay has been previously described in detail (16). In
some experiments, the crystal violet stain assay was used (17).
When using either method, the OD was correlated with the degree of protection from virus-induced cytopathic effect (18). Percent cell protection was calculated as follows: 1
([dilution OD
virus control OD]/[cell control OD
virus control OD]) × 100%, where OD is optical density and dilution OD refers to an
average OD in triplicate wells at the dilution specified. Percent
cell protections were plotted against serial dilutions of the IFN
preparation. End-point titers expressed as laboratory units per milliliter (LU/ml) were taken as reciprocals of dilutions that gave 50%
cell protection. IFN doses (LU/ml, reciprocal of dilutions) were
corrected to IU/ml by calibration with the international reference standard described above.
Antibodies. A mouse anti-human IL-8 mAb of an IgG1 isotype, WS-4, was generated as previously described (18). The isotype-matched normal IgG was obtained from R&D Systems. Antibodies were incubated with IL-8 for 4 h at room temperature. Different molarity ratios were first assessed to determine optimum ratio; a ratio of 3:1 (antibody/IL-8) showed maximal reversal. For immunoprecipiration experiments, antiserum to poliovirus was raised in guinea pigs; the virus was previously purified on sucrose gradient by ultracentrifugation and washed with Tris-HCl buffer (pH 7.4). The antiserum was adsorbed to VERO cells to eliminate antibodies cross-reactive to cellular proteins.
Infectious Virus Yield Titration. For experiments that required virus yield titration, virus was added to cells for 1 h before supernatants were aspirated to remove unadsorbed virus particles. Culture plates were incubated for 24 h at 37°C. The cultures were subjected to freezing and thawing to lyse the cells. Cell lysates that contained both intracellular and extracellular particles were clarified from cell debris by centrifugation. PFUs in the resultant supernatants were quantitated according to standard methods (19) involving VERO cells. The overlay MEM contained either agar (Sigma Chemical Co., St. Louis, MO) in case of EMCV or methylcellulose (Sigma Chemical Co.) for other viruses. The plates were stained with crystal violet to quantitate PFUs.
Poliovirus Polypeptides: Metabolic Labeling, Radioimmunoprecipitation,
and SDS-PAGE.
After cytokine and IFN treatments, VERO
monolayers in 24-well plates were incubated with poliovirus for
1 h. The unadsorbed virus was removed by washing with PBS
buffer. The cultures were incubated for 24 h with methionine-free MEM (GIBCO BRL) supplemented with 2% dialyzed FBS
and 10 µCi of [35S]methionine (Amersham, Buckingham, UK). The
radioactive medium was removed, and monolayers were washed
in PBS. Cells were lysed in gel lysis/radioimmunoprecipitation
(RIPA) buffer (10 mM Tris-HCl, 15 mM NaCl, 1.5 MgCl2, 1%
Triton X-100, 0.25% deoxycholate, 1 mM PMSF, and 15 U/ml
aprotinin) on ice. Lysates were mixed with anti-poliovirus 1 antiserum for overnight at 4°C. The immune complexes were precipitated using 10% suspension of protein A-Sepharose beads
(Pharmacia, Uppsala, Sweden) in blocking buffer (1% BSA-PBS) for 1 h at 4°C. The beads were collected by centrifugation,
washed five times, and resuspended in SDS sample buffer. The
immune complexes were released into the supernatants by boiling
and then electrophoresed in 12% SDS-PAGE. The gels were
fixed, washed, dried, and visualized by autoradiography (Kodak
XAR film; Kodak, Rochester, NY) at
70°C. Before immunoprecipitation, lysates were examined by 12% SDS-PAGE to verify
quality and loading of total proteins. 14C-methylated protein molecular weight markers (14-220 kD) were used to verify the size
of viral proteins.
RNA Preparation and Northern Blot Analysis. Total RNA was extracted by guanidine isothiocyanate method (20) using Tri Reagent (Molecular Research Center, Cincinnati, OH). 20 µg of total RNA was electrophoresed through a 1.2% agarose/2.2 M formaldehyde gel. Northern transfer was performed overnight using Zeta Probe nylon membrane (Bio Rad, Hercules, CA). Membranes were baked and prehybridized in Express Hyb solution (Clonetech, Palo Alto, CA) in a Hybaid Mini Hybridization Oven (Labnet, Woodbridge, NJ). cDNA probes specific for the 0.7-kb 6-16 messenger RNA (mRNA) probe (provided by Dr. Sandra Pellegrini, Pasteur Institute, Paris, France) and 28S ribosomal RNA (American Type Culture Collection) were labeled with [32P]dCTP (Amersham) using nick translation kit (GIBCO BRL). The labeled probes were purified on Sephadex G-50 columns, denatured, added to Express Hyb solution, and hybridized for 1 h at 68°C. The blots were washed and exposed to Kodak X-Omat AR film (Sigma Chemical Co.), and the autoradiograms were subsequently developed.
Reverse Transcriptase PCR and Southern Blotting.
In brief, the
reverse transcriptase (RT) reaction was performed using 5 µg total RNA, 500 ng random hexamer (Random Primers; Promega,
Madison, WI), 500 µM dNTP mixture, 20 U RNAsin (Pharmacia), and 200 U of Moloney murine leukemia virus reverse transcriptase (GIBCO BRL). The samples were heated to inactivate
RT. A pair of primers that amplify both IL-8R A and B
(CXCR1 and CXCR2; Maxim Biotech, Inc., San Francisco,
CA) was used to amplify a 680-bp fragment of the CXCR gene
(21): sense: 5
CTGAACCTAGCCTTGGCCGACCT3
; antisense: 5
TAGATGAGGGGGTTGAGGCAGC3
. Hot start PCR
amplification was performed using Taq DNA polymerase (Promega). cDNA was amplified for 35 cycles at 94°C for 60 s, 60°C
for 60 s, and 72°C for 60 s (Gene Amp PCR System 9600; Perkin
Elmer, Foster City, CA). PCR products were electrophoresed
through a 2% agarose gel and visualized with ethidium bromide.
Size markers (
X 174 DNA/HaeIII fragments) obtained from
GIBCO BRL were used to verify the size of 680-bp fragments.
Southern blotting using Zetaprobe nylon membrane (Bio Rad)
was performed, and the membrane was hybridized with a 40-mer oligonucleotide probe that recognizes CXCR1 and CXCR2 PCR
bands. Its sequence was as follows: 5
TGCTATGAGGACATGGGCAACAATACAGCA3
. The probes was labeled at 5
end with
[
-32P]ATP (Amersham) using T4 polynucleotide kinase (New
England BioLabs, Beverly, MA). Labeled probes were purified on a
Sephadex G-50 column, denatured, and added to the membranes in
Express Hyb solution and hybridized for 1 h at 37°C. The blots were
washed and exposed to Kodak X-Omat AR film (Sigma Chemical Co.), and the autoradiograms were subsequently developed.
,5
-oligoadenylate synthetase (OAS) and 838-bp fragment for
actin, and the oligonucleotide probe used to confirm OAS PCR fragments were previously described in detail (5). RT-PCR for OAS
and
actin gene expression was performed essentially the same as above. The PCR conditions for OAS amplification allowed at
least qualitative comparisons, e.g., significant stimulation or inhibition, of signal strength on agarose gels. These comparisons were
validated by generating PCR products using different cycles in
which the signal strength was within linearity up to 44 cycles.
Competition Receptor Binding Assay. The binding assay was performed in 96-well U-bottom flexible plates (Falcon, Becton Dickinson; Bedford, MA). The wells were first coated overnight with FBS to reduce nonspecific binding (22). WISH or the CXCR-positive THP-1 cells (23) were seeded at 0.5 × 106/well and incubated in a binding buffer (PBS, 1% BSA, and sodium azide) with 106 cpm of 125I-IL-8 specific activity 2,000 Ci/mmol; Amersham) in the presence or absence of 750-fold molar excess of cold IL-8 in each microwell. Plates were then incubated at 4°C for 90 min, centrifuged in an Eppendorf refrigerated centrifuge, and washed three times with PBS/BSA buffer. Cell-bound radioactivity was harvested from the wells in polystyrene tubes and quantified in gamma counter.
OAS Assay. The assay was described in detail elsewhere (5). In brief, cells were lysed by 0.5% NP-40-containing buffer. Equal amounts (1:50 dilution) of lysates were added to tubes containing polyI polyC-agarose at bottom to bind OAS, and unbound materials were washed off by centrifugation. ATP was added to assay tubes and incubated for 1 h at 37°C. OAS converts ATP to 2-5A in which the latter was measured by competitive radioimmunoassay. The amounts of 2-5A (pmol/dl) generated reflects OAS activity. All materials in OAS assay were obtained from Eiken Chemical Co. (Tokyo, Japan).
Statistical Analysis. All comparisons were performed with the Student's paired t test with the aid of GraphPad Prism software (San Diego, CA). Significance was reported with two-tailed P <0.005 unless otherwise described.
Antiviral Action.
We found
that inclusion of recombinant IL-8 in an in vitro assay for
IFN activity (16, 17) significantly reduced the potency of
IFN-
. The assay measures the ability of IFN to protect
human WISH epithelial cells from the cytopathic, (e.g., cytotoxic) effects (CPE) induced by encephalomyocarditis
virus. When target cells were pretreated with IL-8, 90% reduction in IFN-
potency (P <0.005, paired Student's t
test) was consistently observed as assessed by measuring
end-point titers (Fig. 1 A). When the dosage was expressed
in terms of international unitage, the ED50 of IFN-
activity
increased from 1 to 10 IU/ml as a result of IL-8 treatment (Fig. 1 B). IL-8 did not enhance EMCV-induced CPE at
the virus challenge dose, multiplicity of infection equal to
0.1, used in the assay which gave near maximum (90-
100%) CPE. Virus-induced CPE was 90 ± 4% and 95 ± 2%
in the absence or presence of IL-8 (33 ng/ml), respectively.
Also, IL-8 did not affect cell viability (MTS tetrazolium
assay) which was 98 ± 4.5% of cell control in the presence
of IL-8.
antiviral potency. (A)
Confluent WISH cells were
treated with medium or 33 ng/
ml of rIL-8 for 20 h. The cells
were then subjected to the IFN
bioassay as described in Materials and Methods. (B) The reciprocals of dilutions, i.e., IFN
doses in LU/ml, were corrected
to IU/ml by calibration with the
reference standard National Institutes of Health Gxa01-901-535. CPE refers to cytopathic effect in terms of cell destruction. Data are from mean ± SEM of
four experiments.
Dependence of IL-8 Inhibitory Potency on IFN Dose, IFN Type, and IL-8 Dose.
The IL-8 inhibitory potency towards anti-EMCV IFN-
activity was more pronounced at
lower IFN doses (Fig. 1). For example, at 20 IU/ml, the
IFN-mediated inhibition of CPE was 90 and 70% in the
absence and presence of IL-8 treatment, respectively. In contrast, at 1 IU/ml , the IFN-mediated inhibition of viral
CPE decreased from 50 to 8% due to IL-8 treatment (Fig.
1 B).
The inhibitory effect of IL-8 on IFN-
antiviral activity
was dose dependent, yielding an ED50 of ~150 pg/ml (Fig.
2). Maximum inhibition was observed at 10 ng/ml (Fig. 2).
No IL-8 toxicity was seen at the doses tested as judged by
MTS tetrazolium dye; for example, at 100 ng/ml, cell control OD was 1.35 ± 0.02 (n = 4), whereas in the presence
of 100 ng/ml of IL-8, the OD was 1.34 ± 0.04 (n = 4).
Likewise, there was no toxicity observed using either trypan blue exclusion dye or crystal violet staining; in both instances, the IL-8 controls were always 97 ± 3% of cell control.
antiviral activity. Confluent WISH cells were pretreated
with indicated concentrations of
IL-8; cells were then used for the
IFN bioassay as described in Materials and Methods. Percent inhibition refers to percent reduction in original IFN-
potency
(107 IU/ml) in the absence of IL-8 treatment (IFN control, 0% inhibition). Average number of experiments (those with SEM) is four. *Statistical significance at P <0.005 when compared to no IL-8 treatment. Other points could not be statistically analyzed because n = 2 is small.
rIFN-
appeared to be less susceptible to the inhibitory
effect of IL-8 than IFN-
; in four experiments, rIFN-
titers (106 IU/ml) were reduced by 60-80%, whereas IFN-
titers in parallel experiments were inhibited by 85-93%.
Activity.
mAb to IL-8
(WS-4; 18), but not isotype-matched IgG reversed most of
IL-8 inhibitory effect on anti-EMCV IFN-
activity as assessed by reduction in IFN titers (Fig. 3 A). Also, anti-IL-8 was able to reverse the IL-8 inhibitory action on IFN-
activity as assessed by the percentage of IFN-mediated cell
protection from virally-induced CPE (Fig. 3 B).
antiviral activity. (A)
mAb to IL-8 (WS-4) and control isotype-matched IgG, both at a molar
ratio of 3:1, were incubated before addition of IFN-
and followed by
EMCV. Percent of IFN-
control (100%) refers to the original antiviral
IFN-
potency in terms of IFN titers. Data are mean ± SEM of three experiments. (B) Experiments 1 and 2 denote percent inhibition of EMCV-induced CPE due to IFN-
(10 IU/ml). Cell protection was calculated as
described in Materials and Methods. Results in each experiment represent
the means ± SEM of triplicate cultures. *Statistical significance at P < 0.005 when compared to IFN control.
Expression of CXCR (IL-8R) in WISH Cells.
The IL-8
receptors, CXCR1 and CXCR2, are not only expressed
on cells of hematopoietic origin such as neutrophils and monocytes, but also on cells of nonhematopoietic type (23).
Using THP-1 cell line as a positive control for IL-8 receptor (23), we found that WISH cells also contained CXCR
transcripts as assessed by RT-PCR (Fig. 4, top). To confirm
the PCR products, a probe for highly conserved region of
CXCR1 and CXCR2 was used in Southern analysis as revealed in Fig. 4 (bottom). The CXCR transcript was expressed at lower levels in WISH than in THP-1. This may
be attributed to the presence of other homologous chemokine receptor sequences. The lower expression of CXCR
in WISH than in THP-1 cells was also observed in radiobinding competitive experiments (Table 1). Specific binding of 125I-IL-8 due to 750-fold molar excess of unlabeled IL-8 was threefold lower in WISH than in THP-1.
Also, unlabeled IL-8 competed less efficiently in THP-1
than in WISH cells (Table 1).
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Not only did IL-8 attenuate IFN-
antiviral action
against virus-induced CPE, but also against the total (intracellular and extracellular) virus yield from infected cells (see
Fig. 5). This may indicate that IL-8 antagonized IFN-
inhibitory action on viral replication. There was antagonism by
IL-8 (four- to sixfold enhancement of virus yield) in EMCV-infected WISH cells treated with IFN-
doses at 10 IU/ml
and lower (Fig. 5 A). The inhibitory effect of IL-8 on IFN-
-mediated suppression of virus yield was also seen with
poliovirus, as EMCV it is positive-stranded RNA virus of
the family picornaviruses. In this case, there was three- to
sixfold increase in virus yield as a result of IL-8 treatment in
IFN-treated poliovirus-infected WISH cells (Fig. 5 B). Although there was no direct IL-8 enhancement of CPE,
which was maximum at the virus doses used, there was a
slight enhancement (twofold) in virus yield in IL-8-treated
cells used with the picornaviruses (Fig. 5, A and B). The
inhibitory effect of IL-8 on IFN-
action was demonstrated with HSV-1 in MRC-5 (Fig. 5 C). With such
DNA virus, higher doses (e.g., >30 IU/ml; Fig.5 C) were
required to suppress HSV-1 replication. Thus, in case of
HSV-1, these high IFN-
concentrations were still subject
to IL-8 effect. The inhibitory effect of IL-8 on IFN action
could not be demonstrated with the negative-stranded
VSV using either the virus-induced CPE (data not shown)
or virus yield (Fig. 5 D) assays.
at indicated concentrations for 20 h. Viruses were
added at doses that were previously determined to cause maximum CPE
within 24 h. The following virus/cell systems were used: EMCV/WISH
(A), poliovirus/WISH (B), HSV-1/MRC-5 (C), and VSV/normal fibroblasts (D). Infectious virus yield was quantitated in terms of PFU/ml as
described in Materials and Methods. IL-8 itself had no effect on the CPE.
Data are from an average of three experiments. *Statistical significance at
P <0.005 when compared to IFN alone at the indicated concentrations.
VC, virus control; VC+IL-8, virus control that was treated with IL-8. All
other treatments, as indicated, are in the presence of virus.
Effect of IL-8 on Poliovirus Protein Synthesis.
IFNs are known
to intervene with an early stage of picornaviral replication
resulting in inhibition of the formation of viral proteins (1,
2). We had neutralizing antiserum of high titer to poliovirus type 1; poliovirus as EMCV is IFN-sensitive picornavirus and has limited number of distinct proteins. Fig. 6 illustrates that the antiserum recognized at least three of the
four major capsid proteins of poliovirus: VP1 (34 kD), VP2
(28 kD), and VP3 (24 kD), in addition to another band that
may represent one of the precursor or intracellular proteins.
The inhibition of the formation of 35S-labeled poliovirus
proteins showed a clear dose response by IFN-
(Fig. 6).
IL-8 was able to attenuate the IFN-mediated inhibition of
the formation of poliovirus proteins (Fig. 6). IL-8 reversed the IFN-mediated inhibition of viral proteins synthesis particularly at doses 0.1 and 1 IU/ml of IFN-
. IL-8 itself did
not significantly upregulate the protein bands (Fig. 6) with
the cytopathic challenge used in the experiments.
(20 h)
treatment, and then poliovirus. Metabolic labeling, RIPA, and gel electrophoresis were described in Materials and Methods. Cells only, viral immunoprecipitates did not contain cross-reactive bands with cellular proteins as
shown in the region of size markers of 21.5-30 kD. Virus control (V)
shows (from top) at least three of the large polypeptides (VP1, VP2, and
VP3) with an additional band of viral origin possibly corresponding to a
precursor protein.
Kinetics of IL-8 Inhibitory Action on IFN-
Antiviral Activity and Lack of IL-8 Interference with Early IFN Response.
The IL-8 inhibitory effect on IFN activity was similarly
demonstrated whether IL-8 was added before, simultaneously with, or as late as 20 h after IFN treatment (Fig. 7).
This suggests that IL-8 exerted its inhibitory action at a late
rather than early step in IFN-mediated pathway. As shown
in Fig. 8, this was also supported by the lack of changes in
mRNA expression of the 6-16 gene (27) that contains the
IFN-
-stimulated response element that is conserved in
most IFN-
responsive genes (28).
antiviral response.
Confluent WISH cells were subjected to the IFN bioassay as described in Materials and Methods. IL-8 was added at three
different time points in relation
to addition of IFN as indicated.
Percent reduction in original
IFN-
potency (assayed in absence of IL-8 treatment) is
shown as a function of time of
IL-8 addition. Data represents an average of three experiments with
SEM. There were no significant changes among the three columns.
for 4 h. Northern blotting was performed as
described in Materials and Methods. Lane designations are as indicated. (Lane 1) Signal in cell control. (Lanes 2 and 3) Signals due to IL-8
treatment for 4 h and overnight (O/N), respectively. (Lane 4) Signal due
to IFN treatment only for 4 h. (Lanes 5 and 6) Signals due to IFN with 4 h
and overnight treatment of IL-8, respectively. Arrow indicates expected
size of the 0.7-kb 6-16 mRNA and lower panel shows constitutive expression of 28S ribosomal RNA. Data are from one of three experiments
performed.
Effect of IL-8 on the IFN-regulated OAS Activity.
We looked
at the constitutive OAS pathway, a pathway that was reported to correlate with IFN-
action against EMCV, but
not VSV (1, 2). Both EMCV, substantially, and VSV,
moderately, were associated with lower OAS activity,
probably due to their general cytopathic perturbation of
the cells (Fig. 9). However, IL-8 action was associated with
further reduction in OAS activity in the EMCV-infected
IFN-treated cells (Fig. 9). The IL-8 suppressive action on
OAS activity in the presence of IFN-
appears to be linked
to the type of the virus since this was not seen with anti-VSV IFN-
activity (Fig. 9). IL-8 (10 ng/ml) had minimum effect on the cellular constitutive OAS activity in the
presence or absence of IFN-
(Fig. 9). However, at high
doses, e.g., 100 ng/ml, there was 38% inhibition of OAS
activity in WISH cells without affecting cell viability; in three
independent experiments, the OAS activity was 25,800 ± 6,025 and 17,442 ± 3,990 in the absence or presence of
100 ng/ml, respectively.
(10 IU/ml), and infected with EMCV or VSV; control treatments received no virus. Each treatment (in duplicate wells for each experiment) continued for 16-18 h. IL-8 had no effect on cell viability.
WISH cells produce high constitutive levels of OAS and IFN-
at 10 IU/
ml induced further moderate OAS activity. OAS biochemical activity was
assessed by measuring 2
,5
-oligoadenylate generated from ATP by OAS
action (see Materials and Methods). Average number of experiments are
three. *Statistical significance at P <0.01 when compared to values of any
column in the group designated No Virus. C, denote cells.
It appeared that IL-8 had no dramatic effect, e.g., significant inhibition, on IFN-
-induced mRNA expression of
OAS as assessed by RT-PCR (Fig. 10), supporting the hypothesis that IL-8 apparently blocked the antiviral action of
IFN-
at late, e.g., OAS activity, rather than early stage.
for 4 h. RNA was reverse transcribed, amplified
with primers for OAS and
actin, and gel electrophoresed.
Lane designations are as indicated on figure. RT-PCR conditions for OAS gene expression
allowed, at least, qualitative
comparisons, e.g., significant
stimulation or inhibition of signal strength. Identity of OAS fragment was confirmed with oligoprobe
specific to OAS (not shown). Experiment is one of three performed.
Recently, chemokines have attracted the attention of the
biomedical community because of their protective role in
HIV infections and the reports of an ever increasing number of chemokines with novel functions (29). In this study,
we have also demonstrated a novel role for one member of
the chemokine family that, to the best of our knowledge,
has not been previously described. In short, we have provided evidence for the IL-8 inhibition of the antiviral action of IFN-
in several virus-cell systems with emphasis
on EMCV and HeLa line (WISH) as a well-studied model
for IFN action.
The potency of the IL-8 inhibitory effect on IFN-
antiviral action observed here was dependent on IFN-
and
IL-8 doses. The action of IL-8 was more potent at lower
IFN doses (<30 IU/ml). These are still within the physiological concentrations in plasma of healthy individuals, patients with viral diseases, and even patients undergoing
some IFN therapy regimens (33). The IL-8 doses shown
in this report to be effective in inhibition of IFN-
antiviral action were also observed in plasma of subjects with various inflammatory and viral infections (36).
We also demonstrated here that the inhibitory action of
IL-8 on IFN-
antiviral activity was observed at different
stages of virus life cycle: viral protein formation, total virus
yield, and CPE. It is likely that IL-8 action interferes with
IFN-mediated inhibition of viral replication since both the
biosynthesis of viral protein and total virus yield were compromised by IL-8. Of these three, the earliest stage is the
formation of viral proteins. There are two well-characterized pathways for IFN action that results in inhibition of viral
proteins, namely, OAS/RNAse L and double-stranded dependent protein kinase (PKR) pathways. OAS/RNAse L is
thought to control picornaviral viruses such as EMCV and Mengo virus, but not VSV replication (39). Our observations have demonstrated that IL-8 inhibits IFN-
antiviral action against the picornaviruses, EMCV, and poliovirus, but not against VSV. Also, reduction in OAS activity
was seen with EMCV, but not VSV in IFN-treated cells.
Taking these observations together with our previous observations that showed that IL-8 action in EMCV-infected, unlike VSV-infected, cells were associated with decreased
OAS activity (5), suggest that OAS is the late stage that may
be subject to IL-8 action. Thus, the IL-8 selective action in
certain virus-cell systems may be related to which of the
multiple mechanisms that is regulated by IFN to control
the replication of the virus (1, 2, 42). For example, IFN inhibition of HSV-1 replication may not be attributed to OAS
pathway, and the mechanism of IL-8 inhibitory action on
IFN-
activity against HSV-1 may well be different from
those against the picornaviruses.
The observations regarding the timing of IL-8 addition
with respect to IFN-
treatment may indicate that IL-8 induced a nearly IFN-resistant state in the cells before virus
challenge. Also, IL-8 appeared to work at a stage later than
IFN-induced gene expression and protein synthesis, both
of which are normally completed within several hours after
IFN treatment (43). This hypothesis is supported by the
observation that no suppressive influence of IL-8 on IFN-induced expression of 6-16 and OAS genes was qualitatively seen. Thus, it is more likely that the mechanism of
IL-8 action in inhibiting IFN-
antiviral action occurs on
OAS pathway in a manner that is probably independent of
gene expression.
The capacity of viruses to induce IL-8 in vitro and in
vivo (3, 6, 36), the enhancement of viral replication
by IL-8 (4, 5), and the interference with IFN-
antiviral
action against viruses may constitute a common strategy by
which viruses take advantage of the host proteins for their
own survival. This is opposite to the IFN system, which is
to protect cells from viruses, and also shown to inhibit IL-8
synthesis (44).
In the present investigation, we used picornaviruses,
such as EMCV, that are common in the study of IFN system (1, 40). Aside from EMCV and poliovirus, IFN-
-
mediated inhibition of HSV-1 replication seems to be also
compromised by IL-8. However, it is not known whether
IL-8 inhibits IFN action against other viruses such as HIV.
Recently, it was reported that
chemokines (RANTES,
macrophage inhibitory protein-1
, and -1
) and the
chemokine stromal-derived factor 1 can inhibit HIV binding to the coreceptor CC-CKR-5 and CXC-CKR-3, respectively (for review see reference 29). This is not necessarily in conflict with the notion of a potential antagonizing
effect of IL-8 on IFN action in HIV infections. IL-8 binds
to different receptors, CXCR1 and CXCR2, that are expressed by several types of leukocytes and cell types of nonhematopoietic origin including WISH epithelial cells (our
results), fibroblasts, endothelial cells, and keratinocytes (23-
26).
The presence of IL-8 induced by viruses or other stimuli
may contribute, at least partly, to the low potency of IFN
in vivo during therapy and disease. Careful assessment of
these hypothesis in animal models is required. Interference
with IL-8 production or action may suppress viral activity
and/or augment endogenous IFN-
antiviral action against
selected viruses. Also, intervention of IL-8 action or production may be useful as a mean of supplementing IFN-
therapy and hence, enhancing of IFN-
antiviral potency or reduction of its toxicity.
Address correspondence to Dr. Khalid S.A. Khabar, Head, Interferon and Cytokine Research Unit, Department of Biological and Medical Research, MBC-03, King Faisal Specialist Hospital and Research Center, PO Box 3354; Riyadh 11211, Saudi Arabia. Phone: 966-1-442-7878; FAX: 966-1-442-7858; E-mail: khabar{at}kfshrc.edu.sa
Received for publication 5 June 1997 and in revised form 25 July 1997.
1 Abbreviations used in this paper: CMV, cytomegalovirus; CPE, cytopathic effects; EMCV, encephalomyocarditis virus; FBS, fetal bovine serum; LU, laboratory units; mRNA, messenger RNA; MTS, tetrazolium salt; OAS, 2
,5
-oligoadenylate synthetase; RIPA, radioimmunoprecipitation; RT,
reverse transcriptase; VSV, vesicular stomatitis virus.
We would like to thank Dr. John A. Armstrong (University of Pittsburgh, Pittsburgh, PA), and Dr. Malcolm Paterson (King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia) for critical review of the manuscript. We also thank Dr. Sandra Pellegrini (Pasteur Institute, Paris, France) not only for supplying the 6-16 cDNA probe, but also for her helpful comments. The technical assistance of Maud Dzimiri is acknowledged. The authors thank Royspec Purchasing Services of King Faisal Hospital and Research Center in Maryland (Hanover, MD) for expeditious shipping of biological and other materials.
| 1. | Pestka, S., J.A. Langer, K.C. Zoon, and C.E. Samuel. 1987. Interferons and their actions. Annu. Rev. Immunol. 56: 727-777 . |
| 2. |
Sen, G.C., and
P. Lengyel.
1982.
The interferon system. A
bird's view of its biochemistry.
J. Biol. Chem.
267:
5017-5020
|
| 3. | Murayama, T., Y. Ohara, M. Obuchi, K.S.A. Khabar, H. Higashi, N. Mukaida, and K. Matsushima. 1997. Human cytomegalovirus induces IL-8 production by a human monocytic cell line, THP-1, through acting concurrently on AP-1 and NF-kB binding sites of the interleukin-8 gene. J. Virol. 71: 5692-5695 [Abstract]. |
| 4. |
Murayama, T.,
K. Kuno,
F. Jisaki,
M. Obuchi,
D. Sakamuro,
T. Furukawa,
N. Mukaida, and
K. Matsushima.
1994.
Enhancement of human cytomegalovirus replication in a human
lung fibroblast cell line by interleukin-8.
J. Virol.
68:
7582-7585
|
| 5. | Khabar, K.S.A., F. Al-Zoghaibi, T. Murayama, K. Matsushima, N. Mukaida, Y. Siddiqui, M. Dhalla, and M.N. Al-Ahdal. 1997. Interleukin-8 selectively enhances cytopathic effect (CPE) induced by positive-strand RNA viruses in the human WISH cell line. Biochem. Biophys. Res. Commun. 235: 774-778 [Medline]. |
| 6. | Choi, A.M., and D.B. Jacoby. 1992. Influenza virus A infection induces interleukin-8 gene expression in human airway epithelial cells. FEBS Lett. 309: 327-329 [Medline]. |
| 7. | Fiedler, M.A., K. Wereke-Dollries, and J.M. Stark. 1996. Respiratory syncytial virus increases IL-8 gene expression and protein release in A549 cells. Am. J. Physiol. 269: 865-872 . |
| 8. | Sheth, R., J. Anderson, T. Sato, B. Oh, S.J. Hempson, E. Rollo, E.R. Mackow, and R.D. Shaw. 1996. Rotavirus stimulate IL-8 secretion from cultured epithelial cells. Virology. 221: 251-259 [Medline]. |
| 9. |
Baruch-Ben, A.,
D.F. Michiel, and
J.J. Oppenheim.
1995.
Signals and receptors involved in recruitment of inflammatory cells.
J. Biol. Chem.
270:
11703-11706
|
| 10. | Oppenheim, J.J., C.O.C. Zachariae, N. Mukaida, and K. Matsushima. 1991. Properties of the novel proinflammatory supergene "intercrine" cytokine family. Annu. Rev. Immunol. 9: 617-618 [Medline]. |
| 11. | Taub, D.D., M. Anver, J.J. Oppenheim, D.L. Longo, and W.J. Murphy. 1996. T lymphocyte recruitment by interleukin-8. IL-8 induced degranulation of neutrophils releases potent chemoattractants for human T lymphocytes both in vitro and in vivo. J. Clin. Invest. 97: 1931-1941 [Medline]. |
| 12. |
Koch, A.E.,
P.J. Polverini,
S.L. Kunkel,
L.A. Harlow,
L.A. DiPietro,
V.M. Elner,
S.G. Elner, and
R.M. Strieter.
1992.
Interleukin-8 as a macrophage-derived mediator of angiogenesis.
Science (Wash. DC).
258:
1798-1801
|
| 13. |
Cacalano, G.,
J. Lee,
K. Kikly,
A.M. Ryan,
S. Pitts-Meek,
B. Hultgren,
W.I. Wood, and
M.W. Moore.
1994.
Neutrophil
and B cell expansion in mice that lack the murine IL-8 receptor homolog.
Science (Wash. DC).
265:
682-684
|
| 14. |
Matsushima, K.,
K. Morishita,
T. Yoshima,
S. Lavu,
Y. Kobayashi,
W. Lew,
E. Appella,
H.F. Kung,
E.J. Leonard, and
J.J. Oppenheim.
1988.
Molecular cloning of a human
monocyte-derived neutrophils chemotactic factor (MDNCF)
and the induction of MDNCF mRNA by interleukin-1 and
tumor necrosis factor.
J. Exp. Med.
167:
1883-1893
|
| 15. |
Furuta, R.,
J. Yamagishi,
H. Kotani,
F. Sakamoto,
T. Fukui,
Y. Matsui,
Y. Sohmura,
M. Yamada,
T. Yoshimura,
C.G. Larsen,
J.J. Oppenheim, and
K. Matsushima.
1989.
Production and characterization of recombinant human neutrophil
chemotactic factor.
J. Biochem. (Tokyo).
106:
436-441
|
| 16. | Khabar, K.S.A., F. Alzoghaibi, M. Dzimiri, M. Taha, A. Al-Tuwaijri, and M.N. Al-Ahdal. 1996. MTS interferon assay: a simplified cellular dehydrogenase assay for interferon activity using a water-soluble tetrazolium salt. J. Interferon Cytokine Res. 16: 31-33 [Medline]. |
| 17. | Armstrong, J.A.. 1980. Cytopathic effect inhibition assay for interferon: microculture plate assay. Methods Enzymol. 78: 381-387 . |
| 18. | Ko, Y.N., N. Mukaida, A. Pamyutich, N.N. Voitenk, K. Matsushima, T. Kawai, and T. Kasahara. 1992. Establishment of a sensitive enzyme-linked immunosorbent assay for human interleukin-8. J. Immunol. Methods. 149: 227-235 [Medline]. |
| 19. | Lewis, J.A. 1991. Antiviral activity of cytokines. In Cytokines: A Practical Approach. F.R. Balkwill, editor. Oxford University Press, Oxford. 109-120. |
| 20. | Chomczynski, P., and N. Sacchi. 1987. Single step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159 [Medline]. |
| 21. |
Murphy, P.M., and
H.L. Tiffany.
1991.
Cloning of complementary DNA encoding a functional human interleukin-8
receptor.
Science (Wash. DC).
253:
1280-1283
|
| 22. | Higuchi, M., and B.B. Aggarwal. 1992. Microtiter plate radioreceptor assay for tumor necrosis factor and its receptor in large numbers of samples. Anal. Biochem. 204: 53-58 [Medline]. |
| 23. |
Grob, P.M.,
E. David,
T.C. Warren,
R.P. DeLeon,
P.R. Farina, and
C.A. Homon.
1990.
Characterization of a receptor
for human monocyte-derived neutrophil chemotactic factor/
interelukin-8.
J. Biol. Chem.
265:
8311-8316
|
| 24. | Kemeny, L., A.S. Kenderssy, I. Ocsovszky, G. Michel, T. Ruzicka, and A. Dobozy. 1995. Interleukin-8 induces HLA-DR expression on cultured human keratinocytes via specific receptors. Int. Arch. Allergy Immunol. 106: 251-256 . |
| 25. |
Mueller, S.G.,
W.P. Schraw, and
A. Richmond.
1994.
Melanoma growth stimulatory activity enhances the phosphorylation of the class II interleukin-8 receptor in non-hematopoietic
cells.
J. Biol. Chem.
269:
1973-1980
|
| 26. | Schönbeck, U., E. Brandt, F. Petersen, F. Dieter-Han, and H. Loppnow. 1995. IL-8 specifically binds to endothelial but not smooth muscle cells. J. Immunol. 154: 2375-2383 [Abstract]. |
| 27. |
Pellegrini, S.,
J. John,
M. Shearer,
I.M. Kerr, and
G.R. Stark.
1989.
Use of a selectable marker regulated by alpha interferon
to obtain mutations in the signaling pathway.
Mol. Cell. Biol.
9:
4605-4612
|
| 28. |
Darnell, J.E.,
I.M. Kerr, and
G.R. Stark.
1994.
JAK-STAT
pathways and transcriptional activation in response to IFNs
and other extracellular signaling proteins.
Science (Wash. DC).
264:
1415-1421
|
| 29. |
Balter, M..
1996.
A second coreceptor for HIV in early stages
of infection.
Science (Wash. DC).
272:
1740
|
| 30. |
Godiska, R.,
D. Chantry,
C.J. Raport,
S. Sozzani,
P. Allavena,
D. Leviten,
A. Mantovani, and
P.W. Gray.
1997.
Human macrophage-derived chemokine (MDC), a novel chemoattractant for monocytes, monocyte-derived dendritic cells,
and natural killer cells.
J. Exp. Med.
185:
1595-1604
|
| 31. |
Mackay, C.R..
1996.
Chemokine receptors and T cell chemotaxis.
J. Exp. Med.
184:
799-802
|
| 32. | Patel, V.P., B.L. Kreider, Y. Li, H. Li, K. Leung, T. Salcedo, B. Nardelli, V. Pippalla, S. Gentz, R. Thotakura, et al. Molecular and functional characterization of two novel human C-C chemokines as inhibitors of two distinct classes of myeloid progenitors. J. Exp. Med. 185:1163-1172. |
| 33. |
Bernier, J.,
A. Reuter,
Y. Vrindts-Gevaert, and
P. Franchimont.
1984.
Radioimmunoassay of leukocyte (alpha) interferon and its application to some clinical conditions.
J. Nucl.
Med.
25:
765-772
|
| 34. | Bornemann, L.D., H.E. Spiegel, Z.E. Dziewanowska, S.E. Krown, and W.A. Colburn. 1985. Intravenous and intramuscular pharmokinetics of recombinant leukocyte A interferon. Eur. J. Clin. Pharmacol. 28: 469-471 [Medline]. |
| 35. | Shiozawa, S., N. Yoshikawa, K. Iijima, and K. Negishi. 1988. A sensitive radioimmunoassay for circulating alpha-interferon in the plasma of healthy children and patients with measles virus infection. Clin. Exp. Immunol. 73: 366-369 [Medline]. |
| 36. | Matsumoto, T., T. Mike, R.P. Nelson, W.L. Trudeau, R.F. Lockey, and J. Yodoi. 1993. Elevated serum levels of IL-8 patients with HIV infections. Clin. Exp. Immunol. 93: 149-151 [Medline]. |
| 37. | Johnston, S.L.. 1995. Natural and experimental rhinovirus infections of the lower respiratory tract. Am. J. Respir. Crit. Care Med. 152: S46-52 . |
| 38. | al-Wabel, A., B. al-Knawy, and S. Raziuddin. 1995. Interleukin-8 and granulocyte-macrophage colony-stimulating factor secretion in hepatocellular carcinoma and viral chronic active hepatitis. Clin. Immunol. Immunopathol. 74: 231-235 [Medline]. |
| 39. |
Chebath, J.,
P. Benech,
M. Revel, and
M. Vegneron.
1987.
Constitutive expression of (2 -5 ) oligo A synthetase confers resistance to picornavirus infection.
Nature (Lond.).
330:
587-588
[Medline].
|
| 40. | Hassel, B.A., A. Zhou, C. Stomayor, A. Maran, and R.H. Silverman. 1993. A dominant negative mutant of 2-5A- dependent RNase suppresses antiproliferative and antiviral effects of interferon. EMBO (Eur. Mol. Biol. Organ.) J. 12: 3297-3304 [Medline]. |
| 41. |
Rysiecki, G.,
D. Gewart, and
B. Williams.
1990.
Constitutive expression of (2 -5 )-oligo A synthetase cDNA results in
increased antiviral activity and growth suppression.
J. Interferon Res.
9:
649-657
.
|
| 42. | Samuel, C.E.. 1991. Antiviral action of interferon: interferon-regulated cellular proteins and surprisingly selective antiviral activities. Virology. 183: 1-11 [Medline]. |
| 43. | Tanaka, N., and T. Taniguchi. 1992. Cytokine gene expression: regulatory cis-elements and DNA binding factors involved in the interferon system. Adv. Immunol. 52: 263-281 [Medline]. |
| 44. |
Oliveira, I.C.,
N. Mukaida,
K. Matsushima, and
J. Vilcek.
1994.
Transcriptional inhibition of the interleukin-8 gene by
interferon is mediated by the NF-kB site.
Mol. Cell. Biol.
14:
5300-5308
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||