|
||
By


From * Dipartimento di Fisiologia e Patologia and
Istituto di Ginecologia ed Ostetricia, Università
di Trieste, Istituto di Ricovero e Cura a Carattere Scientifico "Burlo Garofolo", Trieste, Italy; § Istituto di
Ricerche Farmacologiche "Mario Negri", Milan, Italy; and
Dipartimento di Biotecnologia, Sezione
di Patologia ed Immunologia, Università di Brescia, Brescia, Italy
The membrane attack complex of complement (C) in sublytic concentrations stimulates endothelial cells (EC) to express adhesion molecules and to release biologically active products. We have examined the ability of a cytolytically inactive form of this complex, which is incapable of inserting into the cell membrane, to upregulate the expression of adhesion molecules and of tissue factor (TF) procoagulant activity. The inactive terminal C complex (iTCC) was prepared by mixing C5b6, C7, C8, and C9 and was purified by fast protein liquid chromatography on a Superose 12 column. Binding of this complex to EC was found to be dose dependent and was inhibited by anti-C9 antibodies, as assessed both by ELISA using an mAb anti-C9 neoantigen and by measuring cell-bound 125I-labeled iTCC. Exposure of EC to iTCC resulted in a dose- and time-dependent expression of endothelial leukocyte adhesion molecule 1, intercellular adhesion molecule 1, and vascular cell adhesion molecule 1 accompanied by increased levels of the corresponding mRNA, but not in the rapid expression of P-selectin. Inactive TCC also induced increased TF activity evaluated by a chromogenic assay that measures the formation of factor Xa. These effects were inhibited by anti-C9 antibodies. The data support the conclusion that iTCC may induce proinflammatory and procoagulant activities on EC.
Endothelial cells (EC)1 are continuously exposed to the
action of biologically active products of the complement (C) system, which are readily available in the circulation after C activation by several stimuli, such as immune
complexes or endotoxin. The major biological effects of
these products on EC is to favor their interaction with circulating leukocytes and to promote migration of these cells
into the inflamed tissue (1). The in vivo relevance of these
C biological activities is supported by the finding that C is
required for the accumulation of neutrophils into the tissue in a rat model of lung injury caused by intrapulmonary deposition of immune complexes or systemic C activation by
cobra venom factor (2).
Various C activation products interact with EC and
stimulate the expression of adhesion molecules as well as
the secretion of proinflammatory factors. Thus, C1q linked
to immune complexes binds to C1q receptor on EC stimulating adhesion of leukocytes and expression of E-selectin,
intercellular adhesion molecule (ICAM)-1, and vascular
cell adhesion molecule (VCAM)-1 (3). Similarly, C5a induces expression of P-selectin and increased adhesion of
neutrophils after interaction with the C5a receptor expressed on EC (4). Also, iC3b molecules deposited on the membrane of EC bind to their ligand CD11b/CD18 on
PMN and cause rapid neutrophil-endothelial adhesion (5).
In the last few years, various groups have reported data
indicating that the membrane attack complex (MAC) of C,
formed by the assembly of the five terminal C components,
exhibits several biologic effects on EC. These include the
release of prostacyclin PGI2 (6), von Willebrand factor (7),
basic fibroblastic growth factor, platelet-activating factor
(8), IL-8, and monocyte chemotactic protein 1 (9). MAC
has also been shown to stimulate the expression of P-selectin (7) and to potentiate the upregulation of E-selectin and
ICAM-1 induced by TNF- The assembly of MAC on EC initiates with the binding
of the C5b-7 complex formed in the fluid phase to the
phospholipid bilayer of the cell membrane followed by activation of C8 and C9. However, the insertion of the C5b-9
complex into the cell membrane is prevented by the action
of two serum inhibitors, vitronectin or S protein (11) and
clusterin (12), and also by the rapid decay of the metastable
binding site transiently exposed in the C7 component of
the complex, although the decayed C5b-7 still binds C8 and C9 forming an inactive terminal C complex (iTCC; 13). The
fate of these inactive complexes and their biological effects
on bystander cells are, to a large extent, unknown. Wang et
al. (14) have recently shown that iC5b67 stimulates PMN
chemotaxis and Ca2+ fluxes, thus extending an original observation made several years ago by Lachmann et al. (15).
These findings suggest that the inactive complexes may not
be functionally irrelevant.
The purpose of the present study is to examine iTCC for
its ability to interact with EC and to induce biological effects. Data will be presented indicating that iTCC not only
binds to these cells, but also upregulates the expression of
adhesion molecules and induces tissue factor activity.
Reagents and C Components.
Recombinant human IL-1 Antibodies.
Goat antisera to C5, C6, and C9 were purchased
from Quidel, and goat IgG directed against C8 was obtained from
Atlantic Antibodies (Scarborough, ME). Antisera to C7 and C9 were
raised in goat and rabbit, respectively, by repeated subcutaneous injections of the purified components and their specificity was checked
by ELISA and Western blotting. The IgG were purified from the
antisera by affinity chromatography on protein G-Sepharose column
(Pharmacia Biotech, Milan, Italy). The mAb aE11 recognizing a
neoantigen of poly (C9) (16) was a gift from T.E. Mollnes (Bodo,
Norway). The following mAb to adhesion molecules were used:
anti-endothelial leukocyte adhesion molecule (ELAM)-1 and
anti-P selectin were from Cymbus Bioscience Ltd. (Southampton,
U.K.), and RR1/1 anti-ICAM-1 (17) and 4B9 anti-VCAM-1 (18)
were obtained through the courtesy of R. Rothlein (Boehringer
Ingelheim, Ridgefield, CT) and J. Harlan (University of Washington, Seattle, WA), respectively. An mAb that recognizes human tissue factor and neutralizes its procoagulant activity was
provided by American Diagnostica Inc. (Greenwich, CT). Alkaline phosphatase-labeled affinity-purified antibodies from goat to
mouse IgG were purchased from Sigma Chemical Co.
Preparation of C5b6.
C5b6 was purified from 300 ml of fresh
frozen human plasma depleted of C7 by immunoaffinity chromatography using cyanogen bromide-activated Sepharose 4B (Pharmacia Biotech) coupled with IgG anti-C7. The fractions eluted from
the column were checked for the presence of C5, C6, and C7 by
ELISA after a procedure previously described in detail (19) with a
sensitivity limit of ~1-3 ng/ml. The fractions containing C5 and
C6 at levels comparable to those of the original plasma and undetectable C7 were pooled and recalcified by the addition of 20 mM
CaCl2. The C5b6 complex was purified from yeast-activated C7depleted serum essentially as described by Harrison and Lachmann (20) with some modifications that included fractionation of
the active material obtained from euglobulin precipitation and
DEAE-Sephacel chromatography through Ultrogel AcA 34 (IBFLKB, Milan, Italy) and final purification by gel filtration on Superose 12 using the fast protein liquid chromatography system
(Pharmacia Biotech). The purified C5b6 had a protein concentration of 800 µg/ml and a hemolytic titer of 250,000 U/ml, where
one unit corresponds to the volume of C5b6 that lyses 2 × 107
guinea pig erythrocytes in 30 min at 37°C in the presence of 2 µl
EDTA human serum to a final volume of 250 µl.
Preparation of iTCC.
The inactive terminal C complex was
obtained by mixing C5b6 (3 µg), C7 (1 µg), C8 (1.5 µg), and
C9 (4 µg) in PBS to a final volume of 50 µl. The concentration
of C7 was chosen to be in slight excess of the amount required to
fully inactivate the hemolytic activity of C5b6 when mixed with
this complex for 10 min at 37°C before the addition of guinea pig
erythrocytes and EDTA serum (20). C8 was present in the mixture in an equimolar ratio to C7, and C9 was added in large excess to favor the polymerization of this component during the assembly of iTCC. The formation of complex was followed by
ELISA using solid phase-bound goat IgG anti-C5 (1/1,000) that
was incubated first with purified C5b6 (300 ng) for 1 h at 37°C,
and, after washing, with a mixture of C7 (100 ng), C8 (150 ng)
and C9 (400 ng) in PBS for 30 min further at 37°C. The amount
of bound TCC was evaluated by its reaction with 1/1,000 aE11
for 1 h at room temperature (RT) followed by 1/4,000 alkaline
phosphatase-conjugated affinity-purified goat anti-mouse antibodies (Sigma Chemical Co.) for 1 h at RT. After addition of
p-nitrophenyl phosphate (1 mg/ml) in 0.1 M glycin buffer, pH
10.4, containing 0.1 mM MgCl2 and 0.1 mM ZnCl2, the enzymatic reaction was developed at 37°C and read kinetically at 405 nm using a Titertek Multiskan ELISA reader (Flow Laboratories, Milan, Italy). The complexes were allowed to form for 30 min at 37°C, for an additional 2 h at RT, and then purified by fast protein liquid chromatography on a Superose 12 column. The iTCC
was also obtained by affinity chromatography on mAb aE11
bound to Protein G-agarose (Sigma Chemical Co.) and crosslinked with dimethyl pimelimidate dihydrochloride according to
Schneider et al. (21). The bound iTCC was eluted with 4 M
guanidine-HCl in 0.1 M sodium phosphate, pH 7, dialyzed first
against 1 mM HCl, and subsequently against PBS. Protein G-agarose column with bound IgG anti-C5 was used in some experiments to absorb purified iTCC. Free C9 multimers were measured by ELISA using solid phase-bound mAb aE11 and goat IgG
anti-C9 labeled with biotin (19) as revealing reagent.
Radiolabeling of C7.
The Iodogen reagent (Pierce, Rockford,
IL) was used to label C7 with 125I following the instructions of
the manufacturer, and the unbound iodine was removed by gel
filtration through Sephadex G25 (Pharmacia Biotech) column.
The labeled C7 was still capable of interacting with C5b6 and its
specific activity was estimated to be 2 × 106 cpm/µg. 125I-C7
was incorporated into iTCC by incubating C5b6 first with the labeled C component for 5 min at 37°C, and subsequently with 10-fold excess cold C7, C8, and C9 following the protocol reported above for the preparation of C5b-9. The labeled complex
was purified through Superose 12 to remove unbound 125I-C7
and the other free terminal components.
Endothelial Cell Culture.
Human umbilical vein endothelial
cells (HUVEC) were prepared according to Jaffe et al. (22) and
cultured in wells of tissue culture plates coated with 2% endotoxin-free gelatin as previously described (23). The cells were kept in
culture either in endotoxin-free medium 199 (Sigma Chemical
Co.) supplemented with 20% newborn calf serum (Hyclone Labs.,
Logan, UT) or in human endothelial serum-free medium (SFM;
GIBCO BRL, Gaithersburg, MD) with fibroblast growth factor
(20 ng/ml) and epidermal growth factor (10 ng/ml).
ELISA on HUVEC.
Binding of iTCC and expression of adhesion molecules on HUVEC were evaluated on cells of the first
passage grown to confluence in 96-well tissue culture plates
(Nunc, Mascia Brunelli, Milan, Italy). After three washings with
HBSS (Sigma Chemical Co.), the cells were exposed to iTCC
in HBSS containing 1% BSA to a final volume of 200 µl for 1 h
at 37°C and the bound complex was quantified as reported above.
The expression of the adhesion molecules on HUVEC was assessed on cells incubated with 100 µl of mAb 4B9 to VCAM-1 (5 µg/ml), mAb RR1 to ICAM-1 (5 µg/ml), mAb 1.2B6 to
ELAM-1 (1 µg/ml), and AK-6 to P-selectin (1 µg/ml) for 1 h at
RT. For the detection of P-selectin, the cells were fixed with 1%
paraformaldehyde in PBS for 15 min at RT in the dark before
exposure to the relevant mAb.
Binding Assay for 125I-iTCC.
The procedure followed to measure the binding of 125I-iTCC to HUVEC was similar to that described for the immunoenzymatic assay except that the cells were
incubated with the labeled complex (~30,000 cpm) in HBSS
containing 1% BSA for 1 h at 37°C. After careful removal of the
supernatants, the cells were washed three times and finally dissolved in 200 µl of 1 M NaOH. Both unbound and cell-bound
radioactivities were counted in a gamma counter (Cobra B5005;
Packard Instruments Company, Meriden, CT) and the results
were expressed as bound 125I-iTCC fractions of the total amounts
of complex added.
Evaluation of Tissue Factor Activity.
A chromogenic assay based
essentially on the method published by Mulder et al. (24) was
used to measure the expression of tissue factor (TF) by endothelial cells. In brief, HUVEC grown to confluence were stimulated
with iTCC or cytokines for 4-6 h and washed three times with
medium 199. The cells were then treated with 0.2 mg/ml collagenase (Worthington Biochemical Corp., Freehold, NJ) in PBS
(~30 µl/well) for 15 min at 37°C. After addition of 250 µl of 10 mM Hepes solution, pH 7.45, supplemented with 137 mM
NaCl, 4 mM KCl, 11 mM glucose, 2.5 mM CaCl2, and 0.5%
BSA to stop the enzymatic reaction, the plates were centrifuged
at 250 g for 10 min and the cell supernatant was gently removed.
The cells sedimented in each well were then incubated with 25 µl
of 50 mM Tris buffer, pH 7.4, containing 0.2% BSA and 0.3 U/ml
of factor VII for 3 min at 37°C followed by 25 µl/well of the
same buffer supplemented with 13 mM CaCl2 and 0.5 U/ml of
factor X for additional 7 min at 37°C. The formation of factor Xa
was evaluated kinetically at 405 nm with the Titertek Multiskan
ELISA reader after the addition of 25 µl of the chromogenic substrate S-2765 (1.87 mM in H2O). Optimal readings were generally obtained after an incubation of 60-90 min at 37°C.
SDS-PAGE and Western Blotting.
TCC was analyzed by SDSPAGE and immunoblotting following a procedure previously described (19) with some modifications that included boiling of the
complex for 5 min in the sample buffer containing 6% SDS, an
electrophoretic run on a 6-10% gradient gel under nonreducing
conditions and the use of the semidry SemiPhor transfer unit
(Heifer Scientific Instruments, San Francisco, CA) for blotting.
Detection of mRNA for Adhesion Molecules.
The procedures for
RNA extraction with phenol-chloroform from cells lysed in a
guanidine thyocianate solution, the reverse transcription with random examers in the presence of Mo-MLV reverse transcriptase
(Perkin-Elmer, Cetus, Norwalk, CT), and the PCR reaction performed to obtain a semiquantitative PCR analysis have previously
been described (25). The oligonucleotides were purchased from
Duotech (Milan, Italy). The following primers were used to amplify the VCAM-1 gene: forward 5
(10). These are noncytotoxic effects elicited by sublytic amounts of MAC that inserts into the plasma membranes of EC without producing overt cytolysis.
(107
U/mg) and TNF-
(2.0 × 107 U/mg) were purchased from
Boehringer Mannheim (Milan, Italy) and Bachem Biochemica
GmbH (Heidelberg, Germany), respectively. LPS from Escherichia coli O55:B5, human coagulation factor VII, bovine factor X,
BSA, histamine, and p-nitrophenyl phosphate were obtained from
Sigma Chemical Co. (Milan, Italy). Thromboplastin and S-2765, the chromogenic substrate for factor Xa, were provided by Chromogenix (Mölndal, Sweden), and the human C components
from C7 to C9 were from Quidel (San Diego, CA).
CAAGTCTACATATCACCCAAGA 3
, from position 758 to position 779, and back
5
GGAACCTTGCAGCTTACAGTGACAGAGCTCCC 3
,
from position 1081 to position 1112, according to the published cDNA (26). The primers employed to amplify the ELAM-1 gene
were the following: forward 5
GGTAGGAACCCAGAAACCTCTGA 3
from position 365 to position 387 and back 5
TTCCCAGATGAGGTACACTGAAG 3
, from position 985 to
position 967 according to the published cDNA (27).
ATP (6,000 Ci/mmol;
DuPont New England Nuclear, Boston, MA) in the presence of
T4 kinase (Boehringer Mannheim GmbH, Mannheim, Germany)
and then passed through Quick Spin Columns (Boehringer Mannheim, GmbH).
TTCTGTGAATCCATCCACAAAGC 3
,
from position 789 to position 811 of the published cDNA sequence (26). The sequence of the internal oligonucleotide to reveal ELAM-1 was as follows: 5
GAGCATGGAAGCCTGGTTTGCAG 3
, from position 675 to position 697 of the published
cDNA (27).
The human
-actin gene was amplified from 5 µl of the same
reverse transcribed mixture using the following primers: forward 5
AAGATGACCCAGATCATGTTTGAG 3
and back 5
GGAGCAATGATCTTGATCTTC 3
as previously reported (25, 28).
Statistical Analysis. Data are reported as mean ± SEM. The Student's t test was used to compare two groups of data.
Mixing C5b6 with the remaining late components in the proportion reported in Materials
and Methods resulted in the formation of TCC that rapidly
lost hemolytic activity. The results presented in Fig. 1
clearly show that lysis induced by the complex dropped to
~25% of the control value in about 30 s from initiation of the complex formation, and was negligible within 1 min of
incubation. By contrast, the time required for the stabilization of the complex was somewhat longer. Thus, the expression of C9 neoantigen, followed as a marker of TCC
formation, though already apparent 1 min after mixing the
C reagents, progressively increased with time reaching its
highest value after 30 min of incubation (Fig. 1). As expected, all the terminal C components, including the C9
dimer, were detected when iTCC was examined by SDSPAGE and Western blotting (Fig. 2). Free C9 multimers
could not be detected in the unretained fraction of iTCC
(1 µg) adsorbed onto IgG anti-C5 bound to protein G-agarose when tested by ELISA using solid phase bound mAb
aE11 and biotin-labeled goat anti-C9 as revealing reagent
with a sensitivity limit of 1-2 ng/ml.
). The assembly of iTCC was measured kinetically by ELISA (
). Details of the assays are given in Materials and
Methods. GPE, guinea pig erythrocytes.
Binding of iTCC to HUVEC.
The interaction of iTCC with the endothelial cells was analyzed with mAb aE11 which recognizes a C9 neoantigen expressed by the complex. The data presented in Fig. 3 A indicate that the amount of iTCC bound to HUVEC was related to the dose of iTCC offered up to 5 µg/ml and showed the tendency to reach a plateau with higher concentrations of the complex. The specificity of these findings was confirmed by the negative results obtained when C5b6 was added to HUVEC cultured in TC199 supplemented with 10% C7-depleted serum or when the cells were exposed to the same amount of purified C9 used for the preparation of iTCC (data not shown). The experiments performed with 125I-iTCC essentially confirmed the results obtained with ELISA and, moreover, showed that the bound complex represents ~1% of the total radioligand added (Fig 3 B).
To evaluate the kinetic of binding of the inactive complex to HUVEC, the cells were incubated with iTCC and
washed at various time intervals to measure the amount of
bound complex. The data presented in Fig. 4 indicate that
approximately half of the total amount of bound complex
could be detected on the surface of EC after 15 min of incubation.
Analysis of iTCC binding to HUVEC in the presence of
polyclonal IgG antibodies directed against the terminal
components revealed a marked inhibitory effect of the antiC9 antibodies, whereas the anti-C6 and the anti-C7 had only
a marginal inhibitory activity and the other antibodies were
ineffective (Fig. 5). The inhibitory effect induced by goat
anti-C9 could also be obtained using rabbit IgG anti-C9.
Expression of Adhesion Molecules on HUVEC Induced by iTCC.
Exposure of HUVEC to iTCC resulted in upregulation of the cell expression of VCAM-1, ICAM-1, and
ELAM-1 (Fig. 6). This effect was dose related and was evident in cells stimulated with 5 µg/ml of iTCC, though the
complex was already active in lower amounts. The complex purified by affinity chromatography with mAb aE11 proved to be more effective than iTCC obtained by gel filtration on Superose 12 inasmuch as it induced a similar expression of adhesion molecules at half the concentration (data
not shown). Kinetic experiments performed with an optimal amount of iTCC (5 µg/ml) showed that the expression
of the three adhesion molecules on the surface of endothelial cells was maximal 6 h after addition of the complex and
persisted up to 24 h in the case of ICAM-1 and VCAM-1,
whereas the expression of ELAM-1 decreased to background level after 12 h of incubation (Fig. 7). Exposure of
HUVEC to the C complex for 1 h followed by washing
was sufficient to induce the expression of the adhesion
molecules after 6 h of incubation, but the amount of detectable molecules was threefold higher in the continuous
presence of the stimulus (data not shown). The upregulation of adhesion molecules obtained with iTCC was significantly inhibited by the addition of goat IgG anti-C9 to the
incubation mixture, but could not be reproduced with C9
alone (5 µg/ml), and the extent of the increased expression
varied between one third and one half that induced by
other well-known stimulating agents, such as IL-1
, TNF-
,
and LPS (Fig. 8). The stimulating activity of the complex
was unaffected by the presence of polymyxin B (5 µg/ml) and
was totally lost when iTCC was boiled for 10 min (data not
shown).
(200 U/ml) in complete SFM containing 1%
BSA. Cells were harvested at the indicated times and examined for
adhesion molecule expression by
ELISA.
(10 U/ml), TNF-
(200 U/ml), and LPS (1 mg/ml) in 200 µl of complete SFM containing 1% BSA. The experimental conditions are similar to those used for Fig. 6. Data showing inhibition of the stimulatory
effect of iTCC by anti-C9 and the effect of C9 are also reported. The results are presented as mean ± SEM of eight different experiments. *P <0.05
versus control; NS, not significant.
The complex was also examined for its ability to stimulate the expression of P-selectin previously shown to be
rapidly induced by sublytic amounts of MAC (7). Fig. 9
shows that iTCC has a negligible effect on the expression
of P-selectin, unlike active TCC and histamine used as
positive controls.
RNA Messages for ELAM-1 and VCAM-1 in iTCC-Treated HUVEC.
To confirm the results observed at the protein
level, HUVEC activated by iTCC and, for comparison, by
IL-1
and LPS or control cells, were examined for the expression of RNA messages for ELAM-1 and VCAM-1 using
the semiquantitative reverse transcriptase PCR (RT-PCR)
reported in Materials and Methods. The analysis was performed on the same RNA preparations purified from an
equal number of cells, that had been stimulated under the
same experimental conditions and then lysed in an equal
volume of guanidine solution before being processed for
the isolation of RNA. The results of ELAM-1 (A) and
VCAM-1 (B) amplification presented in Fig. 10 show a
clear increase in the messages for both molecules in cells
exposed to iTCC, IL-1
, or LPS when compared to the
pattern of the unstimulated cells, despite a comparable
amount of
-actin RNA in all samples. In addition, a previously reported alternatively spliced form of VCAM-1 of
lower molecular size (355 bp; reference 29) can be recognized in cells stimulated by iTCC, IL-1
, and LPS.
-actin
gene. EC (6 × 104) incubated
under the various experimental
conditions for 2 h at 37°C were
lysed in 300 µl of guanidine solution and then processed for
RT-PCR analysis. (lane 1) Control cells; (lane 2) cells treated with 10 U/ml IL-1
; (lane 3) 1 mg/ml LPS; and (lane 4) 5 µg/ml iTCC. Sterile distilled water substituting for RNA was similarly processed as a negative control
(lane 5).
Expression of TF Activity on HUVEC Induced by iTCC.
The ability of iTCC to induce endothelial TF activity was
investigated by exposing HUVEC to the amount of complex (5 µg/ml) that promotes expression of the adhesion
molecules. In a time-course experiment we found that TF
activity was hardly detectable 1 h after addition of iTCC,
but gradually increased starting after 2 h of incubation
reaching the highest level after 6 h (Fig. 11). The stimulating effect of the C complex was approximately one half to
one third lower than that obtained with optimal concentrations of LPS, TNF-
, and IL-1
, used as positive controls,
and was blocked by the presence of IgG anti-C9 (Fig. 12).
Additional experiments showed that TF activity induced
by iTCC was associated with the expression of a molecule
that was inhibited by cycloheximide (10 µg/ml) and was
functionally neutralized by an mAb directed against the TF
protein (data not shown).
, or IL-1
. The cells were incubated for 5 h with the different reagents used at the same concentrations reported in the legend to Fig. 8 and tested for the amount of TF expressed by a chromogenic assay. The results represent the mean ± SEM
of four different experiments. *P <0.05 versus control; NS, not significant.
The data presented in this study show that iTCC binds to HUVEC and stimulates the expression of adhesion molecules and TF, though is unable to insert into the cell membrane. In preparing iTCC, we took advantage of the short half-life of less than 1 min required for TCC to interact as MAC with bystander cells (13, 14). For this reason, the inactive complex was prepared by incubating the mixture of C5b6 and the remaining terminal C components for at least 30 min at 37°C and for an additional 2 h at RT. TCC, prepared under these conditions, was unable to lyse guinea pig erythrocytes, which represent a highly susceptible target for lysis induced by human C complex, and had no cytolytic effect on HUVEC allowing normal survival of these cells in culture.
Binding of iTCC to HUVEC was supported by two sets of data. First, the presence of the complex on the cell surface was revealed by ELISA using mAb aE11, which recognizes only C9 assembled in the TCC, but not the native molecule. The specificity of this finding was confirmed by the observation that aE11 did not react with cells treated with a mixture of C5b6- and C7-depleted serum, a condition that does not allow assembly of the complex. Further evidence was obtained with experiments performed with 125I-labeled complex, that showed binding of ~1% of iTCC to HUVEC.
Based on the results of inhibition experiments with polyclonal antibodies against the terminal C components, we concluded that C9 is the component of the complex that mostly contributes to its interaction with the EC, since the antibody to C9 proved to be the only one to exert a strong inhibitory effect. This finding was not surprising since C9 undergoes a process of polymerization when it is incorporated into the soluble TCC in the absence of vitronectin and clusterin, thus becoming its major constituent with an average number of seven molecules per complex (30). Whether binding of iTCC to endothelial cells is receptor mediated can not be established with the present data and is currently under investigation. However, Wang et al. (14) have recently shown that the inactive form of C5b67 bound to erythrocytes is released from the surface of trypsin-treated cells in higher amounts than the hemolytically active complex suggesting a different type of interaction of the active and inactive complexes with the cell membrane.
The observation that HUVEC exposed to iTCC expressed ELAM-1, ICAM-1, and VCAM-1 clearly indicates
that binding of the inactive complex to these cells has important biological consequences, one of which is to promote the inflammatory process. In this respect, iTCC differs from the cytolytically active complex since Kilgore et al.
(10) recently failed to induce upregulation of these adhesion molecules on HUVEC with MAC alone, despite the
fact that they used a concentration of complex similar to that
of iTCC used in this study. The only effect of MAC that they
were able to see was an enhancement of TNF-
-induced
cell activation.
The expression of ELAM-1, ICAM-1, and VCAM-1 on
HUVEC stimulated by iTCC followed a kinetic pattern
essentially similar to that observed by other groups with
TNF-
and IL-1
(18, 27, 31) and in this study with
TNF-
, although the latter had a tendency to induce a
more rapid and greater response. The lag phase of 4 to 6 h
needed to reveal a clear expression of the three molecules
on HUVEC after the addition of iTCC clearly indicates that protein synthesis was required, as has already been shown for other inducers. This is confirmed by the finding that iTCC induced an increase in the corresponding RNA messages that
preceded the expression of the molecules on the cell surface.
Our major concern was to exclude the possibility that LPS contaminating the C reagents might be responsible for cell activation, but this was ruled out by the findings that the C complex was still effective in the presence of polymyxin B and totally lost its activity after boiling. Further evidence in favor of the specificity of action of iTCC is provided by the data showing inhibition of the stimulatory activity of the C complex by antibodies to C9. Of course, this observation does not exclude the fact that the effect of iTCC can be mediated by soluble C9 or some forms of C9 multimers present in the iTCC preparation, although our failure to detect C9 polymers by ELISA and to induce cell stimulation with native C9 makes the contribution of free C9 highly unlikely. The inability of iTCC to stimulate the rapid expression of P-selectin on HUVEC contrasts with the appearance of this adhesion molecule on the surface of MAC-treated EC originally reported by Hattori et al. (7) and confirmed in the present study. These data again emphasize the differences in the biological effects elicited by the two complexes on HUVEC.
Exposure of endothelial cells to iTCC was sufficient to initiate the extrinsic pathway of coagulation just like treatment of these cells with LPS and other cytokines. The molecule on HUVEC responsible for this activity is recognized by an mAb that is able to block the TF-dependent formation of factor Xa and the consequent hydrolysis of the chromogenic substrate used in our assay system. The induction of TF in endothelium by iTCC requires protein synthesis since the expression of the molecule on the cell surface can be inhibited by the presence of cycloheximide in the incubation mixture.
Saadi et al. (32) have recently shown that MAC stimulates synthesis of TF in porcine EC exposed to human or
rabbit antibodies and human C. This is a model system for
xenotransplants and is basically different from our experimental model not only because it evaluates the effect of a
cytolytically active complex, though tested in sublytic
amounts, but also because the source of MAC is heterologous with respect to the target cells. Under these conditions, MAC operates in the absence of homologous restriction imposed by CD59, which is present on the surface of
EC (33). In addition, in their model TF is expressed over a
period of 16-42 h and requires the release of IL-1
as an
intermediate step, whereas in our system the expression of
TF is observed in ~4-6 h. Despite these differences, however, all together these data provide experimental support
for the contribution of both cytolytically active and inactive TCC to favor accumulation of fibrin deposits and formation of thrombi in vessels in the course of immunemediated disorders associated with persistent and sustained
C activation.
In conclusion, a novel role has been recognized for iTCC that has long been considered an irrelevant by-product of the C activation cascade. The serum levels of the inactive complex reported in various clinical disorders (34) are compatible with the concentrations that were found to be effective in this study. It is quite possible, however, that under conditions of massive C activation, high amounts of iTCC can be formed in vivo, some of which escapes control by vitronectin and clusterin, and that a great proportion of this complex rapidly disappears from the circulation (37) interacting with EC. Such a possibility is suggested by the mild clinical course of meningococcal disease observed in patients with inherited deficiencies of the terminal components, who experience less frequently septic shock, intravascular coagulation, and purpura than C-sufficient patients (38, 39).
Address correspondence to Dr. Francesco Tedesco, Dipartimento di Fisiologia e Patologia, Università di Trieste, Via Fleming 22, 34127 Trieste, Italy.
Received for publication 15 November 1996 and in revised form 4 March 1997.
1Abbreviations used in this paper: C, complement; EC, endothelial cells; ELAM, endothelial leukocyte adhesion molecule; HUVEC, human umbilical vein endothelial cells; ICAM, intercellular adhesion molecule; iTCC, inactive terminal C complex; MAC, membrane attack complex; RT, room temperature; RT-PCR, reverse transcriptase PCR; SFM, serumfree medium; TF, tissue factor; VCAM, vascular cell adhesion molecule.The authors wish to thank Mrs. Nadia Polentarutti for excellent technical assistance. This work was performed in the framework of the E.C. Concerted Action (N° BMH4-CT96-1005) and was supported by grants provided to F. Tedesco from Italian Ministero della Università e della Ricerca Scientifica e Tecnologica (40 and 60%) and Consiglio Nazionale delle Recerche (N° 92.02828.CT04).
| 1. | Foreman, K.E., M.M. Glovsky, R.L. Warner, S.J. Horvath, and P.A. Ward. 1996. Comparative effect of C3a and C5a on adhesion molecule expression on neutrophils and endothelial cells. Inflammation. 20: 1-9 [Medline]. |
| 2. | Vaporciyan, A.A., M.S. Mulligan, J.S. Warren, P.A. Barton, M. Miyasaka, and P.A. Ward. 1995. Up-regulation of lung vascular ICAM-1 in rats is complement dependent. J. Immunol. 155: 1442-1449 [Abstract]. |
| 3. |
Lozada, C.,
R.I. Levin,
M. Huie,
R. Hirschhorn,
D. Naime,
M. Whitlow,
P.A. Recht,
B. Golden, and
B.N. Cronstein.
1995.
Identification of C1q as the heat-labile serum cofactor
required for immune complexes to stimulate endothelial expression of the adhesion molecules E-selectin and intercellular and vascular cell adhesion molecule 1.
Proc. Natl. Acad.
Sci. USA.
92:
8378-8382
|
| 4. | Foreman, K.E., A.A. Vaporciyan, B.K. Bonish, M.L. Jones, K.J. Johnson, M.M. Glovski, S.M. Eddy, and P.A. Ward. 1994. C5a-induced expression of P-selectin in endothelial cells. J. Clin. Invest. 94: 1147-1155 . |
| 5. | Marks, R.M., R.F. Todd III, and P.A. Ward. 1989. Rapid induction of neutrophil-endothelial adhesion by endothelial complement fixation. Nature (Lond.). 339: 314-317 [Medline]. |
| 6. | Suttorp, N., W. Seeger, S. Zinsky, and S. Bhakdi. 1987. Complement complex C5b-8 induces PGI2 formation in cultured endothelial cells. Am. J. Physiol. 253: 13-21 . |
| 7. |
Hattori, R.,
K.K. Hamilton,
R.P. McEver, and
P.J. Sims.
1989.
Complement proteins C5b-9 induce secretion of high
molecular weight multimers of endothelial von Willebrand
factor and translocation of granule membrane protein GMP140 to the cell surface.
J. Biol. Chem.
264:
9053-9060
|
| 8. |
Benzaquen, L.R.,
A. Nicholson-Weller, and
J.A. Halperin.
1994.
Terminal complement proteins C5b-9 release basic fibroblast growth factor and platelet-derived growth factor from
endothelial cells.
J. Exp. Med.
179:
985-992
|
| 9. | Kilgore, K.S., C.M. Flory, B.F. Miller, V.M. Evans, and J.S. Warren. 1996. The membrane attack complex of complement induces interleukin-8 and monocyte chemoattractant protein-1 secretion from human umbilical vein endothelial cells. Am. J. Pathol. 149: 953-961 [Abstract]. |
| 10. |
Kilgore, K.S.,
J.P. Shen,
B.F. Miller,
P.A. Ward, and
J.S. Warren.
1995.
Enhancement by the complement membrane
attack complex of tumor necrosis factor- -induced endothelial cell expression of E-selectin and ICAM-1.
J. Immunol.
155:
1434-1441
[Abstract].
|
| 11. |
Podack, E.R.,
W.P. Kolb, and
H.J. Müller-Eberhard.
1978.
The C5b-9 complex: formation, isolation, and inhibition of
its activity by lipoprotein and the S-protein of human serum.
J. Immunol.
120:
1841-1848
|
| 12. | Murphy, B., L. Kirzbaum, I.D. Walker, and A.J.F. d'Apice. 1988. SP-40,40, a newly identified normal human serum protein found in the SC5b-9 complex of complement and in the immune deposits in glomerulonephritis. J. Clin. Invest. 81: 1848-1864 . |
| 13. | Lachmann, P.J., and R.A. Thompson. 1970. Reactive lysis: the complement-mediated lysis of unsensitized cells. II. The characterization of activated reactor as C56 and the participation of C8 and C9. J. Exp. Med. 131: 643-657 [Abstract]. |
| 14. |
Wang, C.,
S. Barbashov,
R.M. Jack,
T. Barrett,
P.F. Weller, and
A. Nicholson-Weller.
1995.
Hemolytically inactive C5b67
complex: an agonist of polymorphonuclear leukocytes.
Blood.
85:
2570-2578
|
| 15. | Lachmann, P.J., A.B. Kay, and R.A. Thompson. 1970. The chemotactic activity for neutrophil and eosinophil leukocytes of the trimolecular complex of the fifth, sixth and seventh components of human complement (C567) prepared in free solution by the "reactive lysis" procedure. Immunology. 19: 895-899 [Medline]. |
| 16. | Mollnes, T.E., T. Lea, M. Harboe, and J. Tschopp. 1985. Monoclonal antibodies recognizing a neoantigen of poly(C9) detect the human terminal complement complex in tissue and plasma. Scand. J. Immunol. 22: 183-195 [Medline]. |
| 17. |
Dustin, M.L.,
R. Rothlein,
A.K. Bhan,
C.A. Dinarello, and
T.A. Springer.
1986.
Induction by IL-1 and interferon- :
tissue distribution, biochemistry, and function of a natural adherence molecule (ICAM-1).
J. Immunol.
137:
245-254
[Abstract].
|
| 18. |
Carlos, T.,
B.R. Schwartz,
N.L. Kovach,
E. Yee,
M. Rosso,
L. Osborn,
G. Ghi-Rosso,
B. Newman,
R. Lobb, and
J.M. Harlan.
1990.
Vascular cell adhesion molecule-1 mediates
lymphocyte adherence to cytokine-activated cultured human
endothelial cells.
Blood.
76:
965-970
|
| 19. |
Tedesco, F.,
L. Roncelli,
B.H. Petersen,
V. Agnello, and
J. Sodetz.
1990.
Two distinct abnormalities in patients with
C8 - deficiency. Low level of C8 chain and presence of
dysfunctional C8 - subunit.
J. Clin. Invest.
86:
884-888
.
|
| 20. | Harrison, R.A., and P.J. Lachmann. 1986. Complement technology. In Handbook of Experimental Immunology. D.M. Weir, L.A. Herzenberg, C. Blackwell, L.A. Herzenberg, editors. Blackwell, Oxford. 1-49. |
| 21. |
Schneider, C.,
R.A. Newman,
R.D. Sutherland,
U. Asser, and
M.F. Greaves.
1982.
A one-step purification of membrane proteins using a high efficiency immunomatrix.
J. Biol.
Chem.
257:
10766-10769
|
| 22. | Jaffe, E.A., R.L. Nachman, C.G. Becker, and C.R. Minick. 1973. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J. Clin. Invest. 52: 2745-2756 . |
| 23. | Dobrina, A., E. Nardon, E. Vecile, M. Cinco, and P. Patriarca. 1995. Leptospira icterohemorrhagiae and Leptospire peptidolgycans induce endothelial cell adhesiveness for polymorphonuclear leukocytes. Infect. Immun. 63: 2995-2999 [Abstract]. |
| 24. |
Mulder, A.B.,
K.S.M. Hegge-Paping,
C.P.E. Magielse,
N.R. Blom,
J.W. Smit,
J. van der Meer,
M.R. Halie, and
V.J.J. Bom.
1994.
Tumor necrosis factor -induced endothelial tissue factor is located on the cell surface rather than in the endothelial matrix.
Blood.
84:
1559-1566
|
| 25. | Golay, J., F. Passerini, and M. Introna. 1991. A simple and rapid method to analyse specific mRNA from few cells in a semi-quantitative way using the polymerase chain reaction. PCR Methods and Applications 1: 144-145 [Medline]. |
| 26. | Osborn, L., C. Hession, R. Tizard, C. Vassallo, L. Luhowskji, G. Chi-Rosso, and R. Lobb. 1989. Direct expression cloning of vascular cell adhesion molecule-1, a cytokine induced endothelial protein that binds to lymphocytes. Cell. 59: 1203-1211 [Medline]. |
| 27. |
Bevilacqua, M.P.,
S. Stengelin,
M.A. Gimbrone, and
B. Seed.
1989.
Endothelial leukocyte adhesion molecule 1: an
inducible receptor for neutrophils related to complement
regulatory proteins and lectins.
Science (Wash. DC).
243:
1160-1165
|
| 28. |
Golay, J.,
E. Erba,
S. Bernasconi,
G. Peri, and
M. Introna.
1994.
The A-myb gene is preferentially expressed in tonsillar
CD38+, CD39 , and sIgM B lymphocytes and in Burkitt's
lymphoma cell lines.
J. Immunol.
153:
543-553
[Abstract].
|
| 29. | Jonijc, N., I. Martin-Padura, T. Pollicino, S. Bernasconi, P. Jilek, A. Bigotti, R. Mortarini, A. Anichini, G. Parmiani, F. Colotta, et al . 1992. Regulated expression of vascular cell adhesion molecule-1 in human malignant melanoma. Am. J. Pathol. 141: 1323-1330 [Abstract]. |
| 30. | Silversmith, R.E., and G.L. Nelsestuen. 1986. Fluid-phase assembly of the membrane attack complex of complement. Biochemistry. 25: 841-851 [Medline]. |
| 31. | Pober, J.S., M.A. Gimbrone, L.A. Lapierre, D.L. Mendrick, W. Fiers, R. Rothlein, and T.A. Springer. 1986. Overlapping patterns of activation of human endothelial cells by interleukin 1, tumor necrosis factor, and immune interferon. J. Immunol. 137: 1893-1886 [Abstract]. |
| 32. |
Saadi, S.,
R.A. Holzknecht,
C.P. Patte,
D.M. Stern, and
J.L. Platt.
1995.
Complement-mediated regulation of tissue factor
activity in endothelium.
J. Exp. Med.
182:
1807-1814
|
| 33. |
Hamilton, K.K.,
Z. Ji,
S. Rollins,
B.H. Stewart, and
P.J. Sims.
1990.
Regulatory control of the terminal complement
proteins at the surface of human endothelial cells: neutralization of a C5b-9 inhibitor by antibody to CD59.
Blood.
76:
2572-2577
|
| 34. | Falk, R.J., A.P. Dalmasso, Y. Kim, S. Lam, and A. Michael. 1985. Radioimmunoassay of the attack complex of complement in serum from patients with systemic lupus erythematosus. N. Engl. J. Med. 312: 1594-1599 [Abstract]. |
| 35. | Sanders, M.E., E.L. Alexander, C.L. Koski, M.M. Frank, and K.A. Joiner. 1987. Detection of activated terminal complement (C5b-9) in cerebrospinal fluid from patients with central nervous system involvement of primary syndrome or systemic lupus erythematosus. J. Immunol. 138: 2095-2099 [Abstract]. |
| 36. | Gawryl, M.S., D.S. Chudwin, P.F. Langlois, and T.F. Lint. 1988. The terminal complement complex, C5b-9, a marker of disease activity in patients with systemic lupus erythematosus. Arthritis Rheum. 31: 188-195 [Medline]. |
| 37. | Greenstein, J.D., P.W. Peake, and J.A. Charlesworth. 1995. The kinetics and distribution of C9 and SC5b-9 in vivo: effects of complement activation. Clin. Exp. Immunol. 100: 40-46 [Medline]. |
| 38. | Tedesco, F., W. Nürnberger, and S. Perissutti. 1993. Inherited deficiencies of the terminal complement components. Int. Rev. Immunol. 10: 51-64 [Medline]. |
| 39. | Platonov, A.E., V.B. Beloborodov, and I.V. Vershinina. 1993. Meningococcal disease in patients with late complement component deficiency: studies in the USSR. Medicine (Baltimore). 72: 374-392 [Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||