|
||
By
From Schering-Plough, Laboratory for Immunological Research, 69571 Dardilly, France
B lymphocytes undergo affinity maturation of their antigen receptors within germinal centers. These anatomical structures develop in secondary lymphoid organs from the clonal expansion of a few antigen-specific founder B cells, whose isolation and characterization are reported here. Human germinal center founder cells express the naive B cell markers surface IgM and IgD as well as the germinal center B cell markers CD10 and CD38. They express low levels of Bcl-2, high levels of Fas, and undergo rapid apoptosis in culture. The smaller nonproliferating sIgM+IgD+CD38+ B cells displayed a lower level of somatic mutation in their immunoglobulin variable region genes compared with the large proliferating ones. Unmutated sIgM+IgD+CD38+ tonsillar B cells may thus represent germinal center founder cells in which the program for apoptotic cell death is triggered before the onset of somatic mutation, allowing the selection of the germline antibody repertoire at an early stage.
The T cell-dependent primary humoral responses are
initiated by the activation of sIgM+IgD+ naive B cells
in the T cell-rich foci of secondary lymphoid tissues (1),
allowing the generation of short-lived plasma cells and the
recruitment of germinal center (GC)1 founder cells into B
cell follicles (1). These cells undergo clonal expansion,
somatic mutation of their IgV genes (5), and antigendriven affinity maturation (12). The maturation pathway of peripheral B lymphocytes during T cell-dependent
immune response can be traced by changes of surface molecule expression (21). Accordingly, we have previously reported the purification and characterization of five human
tonsillar B cell subpopulations: Bm1 and Bm2 are two subsets of follicular mantle B cells which are sIgD+CD38 Antibodies.
Antibodies (clone number, isotype, and source)
used for phenotyping and immunomagnetic bead depletion are
listed in Table 1.
Table 1.
Antibody List
CD23
and sIgD+CD38
CD23+, respectively; Bm3 and
Bm4 represent sIgD
CD38+CD77+ GC centroblasts and
sIgD
CD38+CD77
centrocytes, respectively; and Bm5
represents sIgD
CD38
memory B cells (11, 22).
However, B cells corresponding to the transition stage
from naive follicular mantle B cells to GC B cells have not
been characterized yet. Recently, we have identified tonsillar B cells that coexpress sIgD and CD38, and that can be further separated into sIgM+ and sIgM
subsets. Sequence
analysis of IgV genes shows that the sIgM
IgD+CD38+
subset contains extensively mutated IgV genes, excluding
the possibility that they could be GC founder cells (26).
Here we present the evidence that the sIgM+IgD+CD38+
subset contains medium sized nonproliferating GC founder
cells that acquire the propensity to undergo apoptosis before the onset of somatic mutation.
Anti-human Abs
Clone
Isotype
Source
CD 2 (FITC)
39 C1.5
IgG2a (rat)
Immunotech (Marseille, France)
CD 3 (FITC)
UCHT 1
IgG1
Immunotech
CD 10-FITC
W8 E37
IgG2a
Becton Dickinson (Mountain View, CA)
CD 14-FITC
RMO 52
IgG2a
Immunotech
CD 19-FITC
J4-119
IgG1
Immunotech
CD 20-FITC
IOB 20b
IgG1
Immunotech
CD 23-PE
B-G6
IgG1
Serotec Ltd. (Oxford, UK)
CD 38
T 10
IgG1
Immunotech
CD 38-PE
HB-7
IgG1
Becton Dickinson
CD 39 (Biot.)
Ac-2
IgG1
The Binding Site (Birmingham, UK)
CD 44-FITC
NaM 10-8F4
IgG1
Diagast (Lille, France)
CD 71-FITC
IOA 71
IgG1
Immunotech
CD 77 sup.
38-13
IgM (rat)
Immunotech
Fas-FITC
UB 2
IgG1
Immunotech
FAS
CH 11
IgM
Immunotech
Bcl2-FITC
IgG1
DAKO (Glostrup, Denmark)
Ki67-FITC
IgG1
DAKO
IgM-FITC
F(ab
)2 (rabbit)
DAKO
Ig D Biot.
IgG (goat)
Amersham Intl. (Buckinghamshire, UK)
Ig A pur.
IgG1
Serotec Ltd.
Ig G pur.
IgG1
Serotec Ltd.
Secondary Abs
Goat anti-mouse-FITC
IgG + IgM
Bioart (Neudon, France)
Goat anti-rat-FITC
IgM
Nordic Immunological Labs. (Tilburg, The Netherlands)
Streptavidin-PE
Becton Dickinson
Streptavidin-FITC
Immunotech
Streptavidin-Tricolor
CALTAG Labs. (South San Francisco, CA)
Ig isotype controls
Mouse IgG1 Biot.
CALTAG Labs.
Mouse IgM
Immunotech
Rat IgG2a FITC
Immunotech
Mouse Ig G1 FITC/PE
Immunotech
Mouse Ig G2A FITC/PE
Immunotech
Immunochemistry reagents
Ig D Biot.
IgG (goat)
Amersham Intl.
IgM
145-8
IgGl
Becton Dickinson
Streptavidin-peroxydase
DAKO
APAAP
DAKO
Isolation of Tonsillar B Cells. Tonsillar B cells were prepared as previously described (25). Briefly, tonsils taken from patients during routine tonsillectomy were finely minced and the resulting cell suspension was subjected to two rounds of depletion of non-B cells: (a) T cells were depleted by rosetting with sheep red blood cells, (b) residual non-B cells were depleted by T cell specific antibodies (CD2, CD3, and CD4), and then by magnetic beads coupled with anti-mouse IgG (Dynabeads; Dynal, Oslo, Norway). The resulting cells from all the experiments contained >98% CD19 positive B cells.
Phenotype Analysis of the Four B Cell Subsets Defined by the Expression of sIgD and sCD38 by Three-color Immunofluorescence Flow Cytometry. Total tonsillar B cells were incubated with mouse anti-human CD38-PE, goat anti-human IgD-biotin, and a set of FITC-conjugated mouse anti-human IgM, CD23, CD44, CD10, CD71, CD77, and Fas/CD95 for 20 min at 4°C. After washing twice with PBS containing 2% BSA, cells were incubated with streptavidin-tricolor for 30 min and analyzed with a FACScan® flow cytometer. For intracellular Bcl-2 and nuclear Ki67 staining, cells were permeabilized by incubation with 3 g/100 ml saponin for 15 min at 4°C.
Separation of IgD+CD38+ Tonsillar B Cells into IgM+ and IgM
Subsets by Three-color Immunofluorescence FACS® Sorting.
Total tonsillar B cells were incubated with mouse anti-human CD38-PE and
goat anti-human IgD-biotin for 20 min at 4°C. After washing
twice with PBS containing 2% BSA, the cells were incubated with
mouse anti-human IgM-FITC and streptavidin-tricolor for 20 min. Then cells were washed twice and suspended in PBS at a concentration of 3 × 106/ml. IgD+CD38+ B cells were separated into
two subsets according to the expression of sIgM on a FACStar plus®.
IgM+IgD+CD38+ B cells from one tonsil were further size fractionated according to their forward scatter parameters.
Giemsa Staining and Analysis of Nuclear Antigen Ki67. 105 cells from each of the purified B cell subsets were cytocentrifuged for 5 min at 500 rpm on a microscope slide. Slides were fixed in methanol for 5 min and then stained with Giemsa staining solution (BDH Chemicals Ltd., Poole, England) diluted one in five with distilled water. Some slides were fixed in cold acetone at 4°C for 10 min for immunocytology. Slides were washed in PBS for 5 min and incubated with mouse mAb against Ki67 antigen (DAKO, Glostrup, Denmark) for 45 min. The slides were washed twice in PBS and then incubated with sheep anti-mouse Ig (The Binding Site, Birmingham, England). After 45 min, slides were washed and incubated with mouse mAb against alkaline phosphatase and alkaline phosphatase complexes (APAAP) (DAKO). After an additional 45 min, the slides were washed three times in PBS and the enzyme activity was developed by the FAST RED substrate (DAKO).
Cell Cultures. Cells were cultured in RPMI 1640 medium containing 10% heat inactivated fetal calf serum, 80 µg/ml gentamicin, and 2 mM glutamine (all from Flow Laboratories, Inc., MacLean, VA) at 37°C. Cells (2.5 × 105/ml) were cultured for 5 d in one of the following conditions: IL-2 (10 U/ml), IL-4 (50 U/ml), or IL-10 (100 ng/ml). 2.5 × 104 CD40-ligand transfected L cells and 2.5 × 103 human fibroblasts from rheumatoid synovium (irradiated with 75Gy) were used for the cultures. DNA synthesis was assessed by an 8 h pulse with 1 µCi [3H]TdR before cell harvesting.
Immunohistology.
Portions of tonsils were snap frozen in liquid nitrogen and stored at
70°C. 5 µm frozen sections were cut
and mounted on glass slides. They were thoroughly dried at room
temperature for
1 h and were fixed in acetone at 4°C for 15 min. Sections were stained by double immunoenzyme technique
using biotin-avidin-peroxidase system and alkaline phosphataseanti-alkaline phosphatase system (APAAP technique). Briefly,
sections were washed in PBS for 5 min. Then sections were incubated with goat anti-human IgD-biotin and mouse anti-human
IgM (IgG1 isotype). After washing for 5 min in PBS, the sections
were incubated with streptavidine-peroxidase and sheep anti-
mouse IgG1 for 30 min, and then incubated with alkaline phosphatase coupled to mouse antibodies specific for alkaline phosphatase (APAAP complexes). After a final wash, peroxidase was
developed by 3-amino-9-ethylcarbazole which gives a red color, and alkaline phosphatase was developed by Fast blue substrate which gives a blue color (27).
Analysis of the VH5 Transcripts PCR Amplified from the Human B
Cell Subsets.
mRNA was extracted from 25 × 103 B cells (11).
cDNA was obtained by reverse transcription using the Superscript
Reverse Transcriptase Kit (GIBCO BRL, Gaithersburg, MD),
with oligo dT12 -18 primers (Pharmacia, Upsalla, Sweden). Full
length VH5 transcripts were amplified with L-VH5 primer
(5
CCCGAATTCATGGGGTCAACCGCCATCCT3
) with 3
primer CHµ (TGGGGCGGATGCACTCCC) with Taq polymerase (Perkin-Elmer Corp., Norwalk, CT) using the reaction
buffer provided by the manufacturers and a DNA thermal cycler
(Perkin-Elmer Corp.) with 35 cycles of 1 min denaturation at
94°C, 2 min of primer annealing at 60°C, and 3 min extension at
72°C. After the last cycle, the reaction mixtures were incubated
for 10 min at 72°C to ensure complete extension of all products.
The PCR products were cloned in PCRTMII vector, using the
TA Cloning Kit (Invitrogen, San Diego, CA). Both DNA strands
of plasmids extracted from individual bacterial colonies were sequenced on an automated DNA sequencer (Applied Biosystems
Inc., Foster City, CA). Sequencing was done with the
21M13
and M13RP primers flanking the plasmid cloning sites, and with
the CHµ primer annealing with the 3
end of CH1-µ.
Human tonsillar B cells that coexpress
sIgD and CD38 have been identified, which represent 5-15%
of total human tonsillar B cells (Fig. 1 A). Three-color flow
cytometry shows that sIgD+CD38+ B cells express low
levels of the naive B cell markers CD23, CD44, and IgM,
while they express high levels of the germinal center markers CD71, CD10, and CD77 (Fig. 1 B). Unlike the
sIgD+CD38
naive B cells, they express low levels of Bcl-2,
high levels of Fas, and many of them express the proliferation associated nuclear antigen Ki67 (Fig. 1 B). The
sIgD+CD38+ B cells were sorted into a sIgM+ subset (3-9%
of total tonsillar B cells) and a sIgM
subset (2-6% of total
tonsillar B cells) (Fig. 1 C). Our recent study has shown
that sIgM
IgD+CD38+ B cells represent a peculiar population of highly mutated GC centroblasts (28). We have now
further characterized the sIgM+IgD+CD38+ B cell subset
which displays a phenotype intermediate between follicular
mantle naive B cells and GC B cells.
subsets.
sIgM+IgD+CD38+ B Cells Display GC B Cell Morphology, Propensity for Apoptosis, and Reduced Proliferation Capacity In Vitro.
Unlike small dense sIgM+sIgD+CD38
naive B
cells, sIgM+IgD+CD38+ B cells are large- or medium-sized
lymphocytes, similar to IgD
CD38+ GC B cells (12, 23).
Large IgM+IgD+CD38+ B cells, which account for 20-
30% of the IgM+IgD+CD38+ B cells, express the proliferation associated nuclear antigen Ki67, while medium-sized
IgM+IgD+CD38+ B cells are Ki67
(Fig. 2 B). Like
IgD
CD38+ GC B cells, >90% of IgM+IgD+CD38+ B
cells display apoptotic figures after 16 h of culture (Fig. 2 C
and Table 2). The survival and proliferation of IgM+
IgD+CD38+ B cells in vitro depend on the presence of
CD40-ligand and T cell cytokines such as IL-2, -4, and -10 (Table 3). The level of DNA synthesis observed under identical culture conditions is always lower in IgM+IgD+CD38+
B cells than in IgD+CD38
naive B cells, but higher than
in IgD
CD38+ GC B cells (Table 3).
naive, slgD
CD38+ GC, and slgM+IgD+CD38+ B cells. (A) Giemsa staining of freshly
isolated three B cell subsets (×1,000). (B) Expression of proliferation associated nuclear antigen Ki67 on freshly isolated B cell subsets (×1,000). (C) Giemsa staining of three B cell subsets after a 16 h culture, showing apoptotic figures in slgM+IgD+CD38+ GC founder cells and in slgD
CD38+ GC B
cells. The quantitation of apoptotic cells is shown in Table 2.
|
||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
VH5-µ sequence analysis has been successfully used to trace the progression of human tonsillar B
cell subsets from the virgin to the memory compartment
(11). Therefore, 32 VH5-µ sequences from sIgM+IgD+
CD38+ B cells were compared to 30 VH5-µ sequences
from sIgM+IgD+CD38
naive B cells of three tonsil samples (Fig. 3, A and B). In agreement with our previous reports, all 30 sequences from naive B cells contain 0-2 mutations per sequence, with an overall mutation frequency of
2 × 10
3 bp (20 mutations/9,600 bp) that is barely distinguishable from the PCR Taq-error rate (1 × 10
3 bp).
Within 32 sequences from sIgM+IgD+CD38+ B cells,
while 17 might be considered germline (0-2 mutations/sequence), 15 have accumulated from 3-13 mutations, with
an average mutation frequency of 20 × 10
3 bp (88 mutations/4,480 bp). The replacement mutations in 12 less mutated sequences (3.2, 3.4, 3.10, 3.14, 3b.5, 3b.6, 3b.9,
3b.13, 3c.5, 3c.7, 3c.9, and 3c.12) are randomly distributed
within the CDRs and FWs, an indication of the absence of
antigen-driven selection. In contrast, sequences 3.11, 3b.7,
and 3c.6, which have accumulated 10-13 mutations, showed
replacement mutations mainly focused in the CDRs, suggesting that these cells have undergone antigen-driven selection. Unlike the VH5-
sequences from sIgD
CD38+
GC B cells and VH5-
sequences from sIgM
IgD+CD38+
reported previously (11, 28), no clonal relatedness could be
found among the VH5-µ transcripts from tonsillar sIgM+
IgD+CD38+ B cells. To establish whether the mediumsized nonproliferating cells from this population are those
with unmutated V regions, sIgM+IgD+CD38+ B cells were
isolated from a fourth tonsil and fractionated according to
their size. The subset of medium-sized sIgM+IgD+CD38+
B cells was enriched for unmutated B cells (Fig. 3, C and D) as five out of nine sequences from the medium-sized B
cells displayed less than two mutations and were therefore
considered as nonmutated. In contrast, only one out of
nine sequences from the large B cells was unmutated. In
those two subsets, the most mutated sequences show features of antigen-driven selection.
, replacement mutation; |, silent mutation;
, stop codon. (A and B) VH5-µ sequences from slgM+IgD+CD38
B cells and
sIgM+IgD+CD38+ B cells, respectively. The upper, middle, and lower groups of sequences represent three different tonsil samples. (C and D) VH5-µ
sequences from medium-sized and large sIgM+IgD+CD38+ B cells, respectively, that were isolated from the fourth tonsil.
IgM+IgD+ B Cells Can Be Found Within GC.
It has been
previously reported that a small proportion of human GC
contain IgD+ B cells (29, 30). Indeed, by double immunohistological staining, we have recently confirmed these observations and further shown that IgD+ B cells within GC
display CD38, the majority of them expressing the proliferation associated nuclear antigen Ki67 (28). To distinguish IgM+IgD+CD38+ GC founder cells from highly mutated
IgM
IgD+CD38+ GC B cells in situ (26), double staining
with anti-IgM and anti-IgD were performed on tonsil sections. While numerous large IgM
IgD+ B blasts were found
to be packed within occasional GC dark zones (26), only
scattered IgM+IgD+ B cells were found throughout a few
GCs (Fig. 4).
B
cells within GC: Double anti-
IgD (red) and anti-IgM (blue)
staining of a tonsil section. (A)
shows a secondary lymphoid follicle that contains purple
IgD+IgM+ follicular mantle B
cells. Within the GC, IgM immune complexes (blue) on follicular dendritic cells can be observed. In addition, scattered
purple IgM+IgD+ B cells and
blue IgM+IgD
B cells can be
found (×100). (B) Shows a part
of this GC at ×200 magnification.
During T cell-dependent primary immune responses,
antigen-specific naive B lymphocytes undergo either plasma
cell reaction in the T cell zones or enter into the B cell follicles to initiate GC reaction. One of the questions regarding GC development has been the identity of GC precursor cells (16, 31, 32). Progress has been made by analyzing
the capacity of B cell subsets to form GC in the host animals after adoptive cell transfer and immunization. SCID
mice immunized after repopulation with carrier-primed
CD4+ T cells and J11Dlow splenic B cells developed many
GC in their spleens. In contrast, when J11Dhigh cells or
CD5+ peritoneal B cells were transferred, few, if any, GC
were generated (33). However, thoracic duct B cell transfer
experiments in rats have generated contradictory conclusions as to whether GC precursor cells are sIgD+ or sIgD
(34, 35). The present identification of tonsillar sIgM+IgD+
CD38+ B cells represents a parallel attempt in the human
system to characterize GC founder cells.
The formal identification of GC founder cells would require the demonstration of a precursor-progeny relationship between such cells and GC mutated B cells. However,
we could not find clonally related unmutated sIgM+sIgD+
CD38+ B cells and mutated sIgD
CD38+ B cells from the
same tonsil within a limited number of sequences (data not
shown). In agreement with our results, when GC B cells were individually picked from the same GC on human
lymph node tissue sections, no clonal relatedness could be
observed between the germline VH/V
sequences and the
mutated sequences (8). It suggests that it might be difficult
to directly illustrate such a precursor-progeny relationship
in humans, since kinetic analysis is not easy to perform.
However, several important features suggest that mediumsized nonproliferating sIgM+IgD+CD38+ B cells might be
enriched for GC founder cells. First, these sIgM+IgD+ B cells
coexpress, albeit at a reduced level, markers of naive B cells
such as CD23 and CD44, as well as markers of bona fide GC B cells such as CD10, CD38, and CD71. As sIgD+
CD38+ B cells are found within GC exclusively, their intermediate phenotype is suggestive of a transitional stage of
maturation between follicular mantle naive B cells and
early GC B cells. Second, 29 out of 32 IgVH clonally independent sequences are either in germline configurations (17 sequences) or are poorly mutated (12 sequences) and
show no clear evidence for antigen-driven selection. Moreover, when sorted according to their size, >50% of the
medium-sized sIgM+IgD+CD38+ B cells are germline or
low mutated, a characteristic expected for early GC B cells.
Third, in contrast to typical GC centroblasts which give
rise, after clonal expansion, to centrocytes, medium-sized sIgM+IgD+CD38+ B cells are not actively dividing as they
are Ki67
. This suggests that these cells have not yet undergone clonal expansion, a conclusion that is supported by
the lack of clonal relatedness between the IgVH sequences
of sIgM+IgD+CD38+ B cells isolated from the same tonsil.
In conclusion, medium-sized, nonproliferating sIgM+IgD+
CD38+ B cells are enriched for early GC B cells.
An important finding of the present study is the early triggering of apoptosis program in sIgM+IgD+CD38+ GC founder cells, which happens before the onset of somatic mutation. This early propensity to undergo apoptosis may provide a mechanism for selection of cells bearing high affinity unmutated antigen receptors within GC. Consequently, only the cells bearing antigen receptors with better affinity will have the opportunity to undergo affinity maturation. This hypothesis is supported by the finding that many PNA+ mouse GC B cells, appearing during the first 10 d of primary response to NP (4-hydroxy-3-nitrophenyl) contained selected IgV genes in germ line or low mutated configurations (7, 36). In addition, this early propensity to undergo apoptosis may also allow the immediate selection of mutating cells (37). Consequently, the B cells entering into GC have to mutate rapidly and efficiently in order to survive.
The demonstration of sIgD on naive B cell derived GC founder cells supports the hypothesis of Thorbecke et al. (16) and Roes and Rajewsky (38) suggesting an auxiliary receptor function for sIgD in antigen-mediated recruitment of B cells into GC reaction and memory B cell formation. This hypothesis was based on the following observations. (a) sIgD are expressed on naive B cells 10 times more efficiently than slgM (39) and bind antigen better than sIgM due to their structural flexibility (40). These two characteristics of sIgD may help naive B cells to colonize the network of follicular dendritic cells when antigen become limiting during GC development (38). (b) A subpopulation of helper T cells bearing receptors for sIgD was found to play an important role in enhancing T cell-dependent humoral immune responses (41, 42). (c) In vivo injection of anti- mouse IgD dramatically increases, within 6 d, the volume of GC in the spleen (43). (d) IgD-knock out mice displayed a delayed affinity maturation of T cell-dependent antibody responses (38) and a higher sensitivity to tolerance induction (44).
The present demonstration of sIgD on GC founder cells also sets a limit to the concept of sIgD being an absolute marker for naive resting B cells. This concept was essentially based on the rapid loss of sIgD on naive B cells after activation in vitro and in vivo (45, 46), and the apparent lack of IgD expression in GC (21). However, consistent with our present identification of sIgD+ proliferating GC founder cells in vivo, sIgD+ proliferating B cells were observed in long-term culture of CD40 activated human naive B cells (47). Furthermore, the three VH-5µ sequences with more than 10 mutations showed evidence for antigendriven selection. These three mutated sIgM+IgD+CD38+ B cells may either represent GC founder cells derived from recirculating sIgM+IgD+ memory B cells or correspond to GC centrocytes currently differentiating into sIgM+IgD+ memory B cells. Therefore, our present findings further support the existence of sIgD+ memory B cells, demonstrated in mouse adoptive transfer experiments a decade ago (48, 49).
In conclusion, human GC founder cells have been isolated as medium-sized, nonproliferating sIgM+IgD+CD38+ B cells. Further study of this subpopulation of B cells should lead to better understanding of the early events governing GC development.
Address correspondence to Drs. Serge Lebecque and Yong-Jun Liu, Schering-Plough, 27 chemin des Peupliers, BP11, 69571 Dardilly, France.
Received for publication 29 March 1996
C. Arpin is recipient of a grant from Fondation Narcel Nérieux (Lyon, France).We thank Drs. F. Brière and P. Garrone for critical reading of the manuscript, Dr. J. Chiller for support, Mrs. Bonnet-Arnaud and Mrs. Vatan for editorial assistance, and Ms. I. Durand for cell sorting.
| 1. | Liu, Y.-J., J. Zhang, P.J.L. Lane, E.Y.-T. Chan, and I.C.M. MacLennan. 1991. Sites of specific B cell activation in primary and secondary responses to T cell-dependent and T cell- independent antigens. Eur. J. Immunol. 21: 2951-2962 [Medline] . |
| 2. |
Jacob, J.,
R. Kassir, and
G. Kelsoe.
1991.
In situ studies of
the primary immune response to (4-hydroxy-3-nitrophenyl)
acetyl. I. The architecture and dynamics of responding cell
populations.
J. Exp. Med.
173:
1165-1175
|
| 3. | Kroese, F.G.M., A.S. Wubbena, H.G. Seijen, and P. Nieuwenhuis. 1987. Germinal centers develop oligoclonally. Eur. J. Immunol. 17: 1069-1072 [Medline] . |
| 4. | Smith, K.G.C., T.D. Hewitson, G.J.V. Nossal, and D.M. Tarlinton. 1996. The phenotype and fate of the antibodyforming cells of the splenic foci. Eur. J. Immunol. 26: 444-448 [Medline] . |
| 5. | Jacob, J., G. Kelsoe, K. Rajewsky, and U. Weiss. 1991. Intraclonal generation of antibody mutants in germinal centres. Nature (Lond.). 354: 389-392 [Medline] . |
| 6. | Berek, C., A. Berger, and M. Apel. 1991. Maturation of the immune response in germinal centers. Cell. 67: 1121-1129 [Medline] . |
| 7. |
McHeyzer-Williams, M.G.,
M.J. McLean,
P.A. Lalor, and
G.J.V. Nossal.
1993.
Antigen-driven B cell differentiation in
vivo.
J. Exp. Med.
178:
295-307
|
| 8. | Küppers, R., M. Zhao, M.-L. Hansmann, and K. Rajewsky. 1993. Tracing B cell development in human germinal centres by molecular analysis of single cells picked from histological sections. EMBO (Eur. Mol. Biol. Organ.) J. 12: 4955-4967 [Medline] . |
| 9. | Leanderson, T., E. Källberg, and D. Gray. 1992. Expansion, selection and mutation of antigen-specific B cells in germinal centers. Immunol. Rev. 126: 47-61 [Medline] . |
| 10. |
Klein, U.,
R. Küppers, and
K. Rajewsky.
1994.
Variable region gene analysis of B cell subsets derived from a 4-year-old
child: somatically mutated memory B cells accumulate in the
peripheral blood already at young age.
J. Exp. Med.
180:
1383-1393
|
| 11. |
Pascual, V.,
Y.J. Liu,
A. Magalski,
O. de Bouteiller,
J. Banchereau, and
J.D. Capra.
1994.
Analysis of somatic mutation in five B cell subsets of human tonsil.
J. Exp. Med.
180:
329-339
|
| 12. | Liu, Y.J., D.E. Joshua, G.T. Williams, C.A. Smith, J. Gordon, and I.C.M. MacLennan. 1989. Mechanisms of antigendriven selection in germinal centers. Nature (Lond.). 342: 929-931 [Medline] . |
| 13. | MacLennan, I.C.M., and D. Gray. 1986. Antigen-driven selection of virgin and memory B cells. Immunol. Rev. 91: 61-85 [Medline] . |
| 14. | MacLennan, I.C.M.. 1994. Germinal centers. Annu. Rev. Immunol. 12: 117-139 [Medline] . |
| 15. | Nossal, G.J.V.. 1992. The molecular and cellular basis of affinity maturation in the antibody response. Cell. 68: 1-3 [Medline] . |
| 16. | Thorbecke, G.J., A.R. Amin, and V.K. Tsiagbe. 1994. Biology of germinal centers in lymphoid tissues. FASEB J. 8: 832-840 [Abstract] . |
| 17. | Banchereau, J., and F. Rousset. 1992. Human B lymphocytes: phenotype, proliferation and differentiation. Adv. Immunol. 52: 125-251 [Medline] . |
| 18. | Clark, E.A., and J.A. Ledbetter. 1994. How B and T cells talk to each other. Nature (Lond.). 367: 425-428 [Medline] . |
| 19. | Weissman, I.L.. 1994. Developmental switches in the immune system. Cell. 76: 207-218 [Medline] . |
| 20. | Rajewsky, K. 1989. Evolutionary and somatic immunological memory. In Progress in Immunology. VII. F. Melchers, editor. Springer-Verlag, Berlin. 397-403. |
| 21. | Liu, Y.J., G.D. Johnson, J. Gordon, and I.C.M. MacLennan. 1992. Germinal centers in T-cell-dependent antibody responses. Immunol. Today. 13: 17-21 [Medline] . |
| 22. | Liu, Y.J., C. Barthélémy, O. de Bouteiller, and J. Banchereau. 1994. The differences in survival and phenotype between centroblasts and centrocytes. In In Vivo Immunology. E. Heinen, editor. Plenum Press, New York. 213-218. |
| 23. | Liu, Y.J., C. Barthélémy, O. de Bouteiller, C. Arpin, I. Durand, and J. Banchereau. 1995. Memory B cells from human tonsils colonize mucosal epithelium and directly present antigen to T cells by rapid upregulation of B7.1 and B7.2. Immunity 2: 238-248 . |
| 24. |
Martinez-Valdez, H.,
C. Guret,
O. de Bouteiller,
I. Fugier,
J. Banchereau, and
Y.J. Liu.
1996.
Human germinal center B
cells express the apoptosis inducing genes Fas, c-myc, p53, and
Bax but not the survival gene blc-2.
J. Exp. Med.
183:
971-977
|
| 25. | Liu, Y.J., and J. Banchereau. 1996. Human peripheral B cell subsets. In Handbook of Experimental Immunology. D. Weir, C. Blackwell, and L. Hersenberg, editors. Blackwell Scientific Publ., Oxford. In press. |
| 26. | Liu, Y.J., F. Malisan, O. de Bouteiller, C. Guret, S. Lebecque, J. Banchereau, F.C. Mills, E.E. Max, and H. Martinez-Valdez. 1996. Within germinal centers isotype switching of immunoglobulin genes occurs after onset of somatic mutation. Immunity. 4: 241-250 [Medline] . |
| 27. | Liu, Y.J., S. Oldfield, and I.C.M. MacLennan. 1988. Memory B cells in T cell-dependent antibody responses colonize the splenic marginal zones. Eur. J. Immunol. 18: 355-362 [Medline] . |
| 28. |
Liu, Y.J.,
O. de Bouteiller,
C. Arpin,
F. Brière,
L. Galibert,
S. Ho,
H. Martinez-Valdez,
J. Banchereau, and
S. Lebecque.
1996.
Normal human IgD+IgM germinal center B cells can
express up to 80 mutations in the variable region of their IgD
transcripts.
Immunity.
4:
603-613
[Medline]
.
|
| 29. | Hsu, S.M., and E.S. Jaffe. 1994. Phenotypic expression of B-lymphocytes. 2. Immunoglobulin expression of germinal center cells. Am. J. Pathol. 114: 396-402 [Abstract] . |
| 30. | Nahm, M.H., P.A. Takes, M.B. Bowen, and K.A. Macke. 1989. Subpopulations of B lymphocytes in germinal centers. II. A germinal center B cell subpopulation expresses sIgD and CD23. Immunol. Lett. 21: 201-208 [Medline] . |
| 31. | Thorbecke, G.J., T.J. Flotte, and Y. Baine. 1982. Maturity of precursor cells for germinal centers. Adv. Exp. Med. Biol. 149: 845-847 [Medline] . |
| 32. | Nieuwenhuis, P., and D. Opstelten. 1984. Functional anatomy of germinal centres. Am. J. Anat. 170: 421 [Medline] . |
| 33. | Linton, P.J., D. Lo, L. Lai, G.J. Thorbecke, and N.R. Klinman. 1992. Among naive precursor cell subpopulations only progenitors of memory B cells originate germinal centers. Eur. J. Immunol. 22: 1293-1297 [Medline] . |
| 34. | Seijen, H.G., J.C.A.M. Bun, A.S. Wubbena, and K.G.L. Loehlefink. 1988. The germinal center precursor cell is surface IgM and IgD positive. Adv. Exp. Med. Biol. 237: 233-237 [Medline] . |
| 35. |
Vonderheide, R.H., and
S.V. Hunt.
1991.
Comparison of
IgD+ and IgD thoracic duct B lymphocytes as germinal
center precursor cells in the rat.
Int. Immunol.
3:
1273-1281
|
| 36. |
Jacob, J.,
J. Przylepa,
C. Miller, and
G. Kelsoe.
1993.
In situ
studies of the primary immune response to (4-hydroxyl3-nitrophenyl) acetul. III. The kinetics of V region mutation
and selection in germinal center B cells.
J. Exp. Med.
178:
1293-1307
|
| 37. | Weiss, U., R. Zoebelein, and K. Rajewsky. 1992. Accumulation of somatic mutants in the B cell compartment after primary immunization with a T cell-dependent antigen. Eur. J. Immunol. 22: 511-517 [Medline] . |
| 38. |
Roes, J., and
K. Rajewsky.
1993.
Immunoglobulin D (IgD)-
deficient mice reveal an auxiliary receptor function for IgD in
antigen-mediated recruitment of B cells.
J. Exp. Med.
177:
45-55
|
| 39. | Brink, R., C.C. Goodnow, and A. Basten. 1995. IgD expression on B cells is more efficient than IgM but both receptors are functionally equivalent in up-regulation CD80/CD86 co-stimulatory molecules. Eur. J. Immunol. 25: 1980-1984 [Medline] . |
| 40. | Blattner, F.R., and P.W. Tucker. 1984. The molecular biology of immunoglobulin D. Nature (Lond.). 307: 417-422 [Medline] . |
| 41. | Coico, R.F., B. Xue, D. Wallace, B. Pernis, G.W. Siskind, and G.J. Thorbecke. 1985. T cells with receptors for IgD. Nature (Lond.). 316: 744-746 [Medline] . |
| 42. |
Coico, R.F.,
G.W. Siskind, and
G.J. Thorbecke.
1988.
Role
of IgD and T cells in the regulation of the humoral immune
response.
Immunol. Rev.
105:
45-67
[Medline]
.
|
| 43. | Flotte, T.J., F.D. Finkelman, and G.J. Thorbecke. 1984. Polyclonal activation of the murine immune system by antibody to IgD V. Effect on germinal centers. Eur. J. Immunol. 14: 725-728 [Medline] . |
| 44. | Carsetti, R., G. Köhler, and M.C. Lamers. 1993. A role for immunoglobulin D: interference with tolerance induction. Eur. J. Immunol. 23: 168-178 [Medline] . |
| 45. | Monroe, J.G., W.L. Havran, and J.C. Cambier. 1983. B lymphocyte activation: entry into cell cycle is accompanied by decreased expression of IgD but not IgM. Eur. J. Immunol. 13: 208-213 [Medline] . |
| 46. |
Black, S.J.,
W. Van der Loo,
M.R. Loken, and
L.A. Herzenberg.
1978.
Expression of IgD by murine lymphocytes. Loss
of surface IgD indicates maturation of memory B cells.
J.
Exp. Med.
147:
984-996
|
| 47. | Galibert, L., I. Durand, F. Rousset, and J. Banchereau. 1994. CD40 activated surface IgD positive lymphocytes constitute the long term IL-4 dependent proliferating B cell pool. J. Immunol. 152: 22-29 [Abstract] . |
| 48. | Lafrenz, D., S. Strober, and E. Vitetta. 1981. The relationship between surface immunoglobulin isotype and the immune function of murine B lymphocytes. V. High affinity secondary antibody responses are transferred by both IgD-positive and IgD-negative memory B cells. J. Immunol. 127: 867-872 [Abstract] . |
| 49. |
Herzenberg, L.A.,
S.J. Black,
T. Tokuhisa, and
L.A. Herzenberg.
1980.
Memory B cells at successive stages of differentiation. Affinity maturation and the role of IgD receptors.
J.
Exp. Med.
151:
1071-1087
|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||