|
||
By


From the * Institute for Biochemistry,
Swiss Institute for Experimental Cancer Research, University of
Lausanne, 1066 Epalinges, Switzerland; and § Institute for Microbiology, University of Lausanne,
1011 Lausanne, Switzerland
Mouse mammary tumor virus (MMTV) is a B type retrovirus transmitted to the suckling offspring through milk. MMTV crosses the intestinal barrier of neonates, initially infects the lymphoid cells of the Peyer's patches, and later spreads to all lymphoid organs and to the mammary gland. Adult mice can be infected systemically, but not by oral MMTV administration. In this study, we show that nasal administration of infected milk induces the infection of adult mice. Nasal MMTV infection shared the main features of systemic and neonatal intestinal MMTV infections: deletion of the superantigen (SAg)-reactive T cell subset from the peripheral T cell population, presence of viral DNA in lymphoid cells, and transmission of MMTV from mother to offspring. Viral DNA was restricted to the lungs and nasal-associated lymphoid tissue (NALT) 6 d after nasal infection. Furthermore, SAg-induced T cell proliferation was only detected in NALT. These results demonstrate that MMTV crosses the intact epithelium of the upper respiratory tract of adult mice and infects the lymphoid follicles associated with these structures.
Mouse mammary tumor virus (MMTV) is a B type
retrovirus present in the milk of lactating infected
female mice (1). Infectious MMTV, in contrast to other
viruses, requires an intact immune system to establish an
efficient, lifelong infection and to complete its life cycle.
MMTV crosses the intestinal barrier of neonates and initially infects the lymphoid cells of the Peyer's patches (PP),
later spreading to all lymphoid organs and to its final target
the epithelial cells of the mammary gland (2). After footpad
injection of infectious MMTV, MMTV primarily infects B cells in the draining popliteal lymph nodes (3). After integration of the MMTV genome in B cells, a protein with a
superantigenic activity is produced (SAg molecule), which,
in the context of MHC class II, triggers an intense proliferation of CD4+ T cells expressing the appropriate T cell receptor V Although systemic infection has been intensively analyzed, little is known about the early steps in mucosal infection. The critical elements allowing mucosal infection by
MMTV have not been elucidated. One can hypothesize
that uptake and transport of MMTV across the intestinal
barrier is mediated by a receptor. As adult mice are resistant
to oral infection, such a receptor should be downregulated
at weaning, its disappearance correlating with the onset of
intestinal resistance to MMTV (5). We could exclude that
the neonatal Fc receptor, which is expressed by enterocytes during the first 2 wk of life, mediates the transport of
MMTV across the intestinal barrier (5). M cells are specialized epithelial cells which deliver samples of foreign material by transepithelial transport from the lumen to underlying organized lymphoid tissues within the mucosa (6, 7). It
is possible that MMTV could cross the intestinal mucosa
via M cells. If M cells are able to mediate transport, it is difficult to understand why infection is restricted to the neonatal period, since M cells are present both in newborns
and adults. The resistance to oral MMTV infection after
weaning may also reflect the postnatal maturation of the digestive functions of the gastrointestinal tract.
We hypothesized that mucosal MMTV infection is not
restricted to the neonatal period, and that other lymphoid
organs associated with an epithelium other than the intestinal epithelium could be the site of MMTV entry. We infected adult mice with MMTV by the nasal route to gain
access to the mucosal lymphoid organs associated with the
nasal cavity and the lungs. We found that MMTV, when
given nasally, infects adult mice. Furthermore, we localized
the initial site of viral propagation to the mucosal-associated lymphoid organs of the nasal cavity. We could detect
both the proliferation of the T cell subset induced by the
SAg molecule and viral DNA in the nasal associated lymphoid tissue (NALT) 6 d after intranasal administration of
infected milk. Viral DNA was also detected in lungs at this
time, but not the SAg-reactive T cell proliferation. Altogether, these results show that MMTV can infect adult
mice by a mucosal route, and that MMTV can initiate its
infectious cycle in lymphoid tissues associated with the nasal cavity.
Mice.
BALB/c mice were obtained from Harlan Olac (London, U.K.). MMTV (SW)-infected mice were obtained from
IFFA Credo (L'Arbresle, France) and bred in our animal facility.
Virus Preparation and Infection.
Milk was prepared as described
earlier (5). For nasal MMTV infection, adult mice (8-10-wk-old)
were anesthetized by the injection of a mixture of ketasol (Dr. E. Gräub, Bern, Switzerland) and rompun (Bayer, Zurich, Switzerland). Infected milk was diluted to 1:2 in PBS and 20 µl pipetted
into the nostrils of the mice.
Isolation of Lymphoid Cells.
Peripheral blood was taken from
the tail vein and mononuclear cells were isolated by centrifugation
of heparinized samples (diluted with PBS) on a Ficoll-Hypaque
(Pharmacia, Uppsala, Sweden) cushion. Lymph nodes, spleen, and
thymus were dissociated mechanically. PP were recovered as described earlier (2). The intraparenchymal lung lymphoid cells
were prepared as described by Abraham et al. (8) with a few
modifications. The lung vascular bed was flushed by injection of
5-10 ml chilled (4°C) heparinized PBS into the right ventricle. At
this time, the color of the lungs became white. The lungs were
excised, washed twice in ice-cold PBS, minced finely, and then
incubated in 5 ml of RPMI 1640 with 10% FCS containing 110 and 80 U/ml, respectively, of type II and IV collagenases (CII-28
and CIV-28; Seromed, Berlin, Germany). The suspensions were
gently shaken at 37°C in a 15-ml conical tube (model 2095; Falcon, Basel, Switzerland) for 75 min. After incubation, the largest
lung pieces were dissociated mechanically and the suspension was
left to sediment for 10 min at 4°C. The supernatants were filtered
through a cell strainer (2350; Becton Dickinson, San Jose, CA)
and centrifuged (4°C). The pellets were recovered in 4 ml of 40%
Percoll solution (17-0891-01; Pharmacia), layered on a 4-ml
cushion of 80% Percoll solution, and centrifuged for 15 min at
1,900 g (15°C). The cells of the interface were recovered and
washed in ice-cold RPMI, 10% FCS and used for FACS® analysis
or DNA preparation. For NALT isolation, the mice were killed
by cervical dislocation, and the skin and excess soft tissue from
the head were removed. The skull of the mouse was cut off with
a large (No. 10) scalpel 5 mm behind the eyes. The lower jaw
was removed and the end of the snout was cut off just behind the
upper incisor tooth. For DNA sample preparation, the snout was
cut along the nasal septum and the lymphoid tissues located near
to the base of the nasal cavity were removed with the end of a
scalpel. The tissues obtained were treated as for the minced lung
preparations, i.e., collagenase digestion and the recovery of lymphoid cells after a Percoll gradient. For analysis of the lymphoid
cell population present in NALT by FACS®, the snout was prepared as described above and the epithelium of the roof of the
upper jaw was carefully removed under dissecting lens. The
NALT, identified as two small longitudinal strips of tissue attached to the palate was dissected out and mechanically dissociated to obtain lymphoid cell suspensions.
Flow Cytometry.
Lymphoid cells from different lymphoid organs or blood were labeled with a mixture of anti-CD4 (anti-L3T4,
PE conjugate; CALTAG, South San Francisco, CA) and affinity
purified, FITC-conjugated anti-V Detection of Viral DNA.
Cells derived from different lymphoid organs (5 × 106) were washed in Tris-buffered saline, pH 7.4, and the DNA was phenol extracted after proteinase K treatment
using a standard technique (11). DNA was ethanol-precipitated,
redissolved in 100 µl of 10 mM Tris (pH 8.0)-0.1 mM EDTA,
and 0.5 µl was used in PCR amplification reactions. Oligonucleotides were chosen to amplify MMTV (SW) orf sequences exclusively. The 5 The establishment of an efficient MMTV infection is characterized by the deletion from the peripheral T
cell population of the T cell subset reactive to the SAg
molecule encoded by the infectious MMTV (13). Hence,
efficient MMTV infection can be easily detected by the
disappearance from the peripheral lymphoid organs or blood
of the SAg-reactive T cells. Anesthetized adult mice were
administered intranasally with PBS, or with uninfected or
infected milk. Blood was taken 5 and 10 wk after nasal administration and the presence of SAg-reactive T cells in
peripheral blood was measured by flow cytometry. Fig. 1
shows that adult mice delete from their peripheral blood
lymphocytes the CD4+V
We tested whether MMTV completes
its life cycle after nasal infection of adult mice, i.e., whether
nasally infected adult female mice could transmit the disease
to their offspring. We mated nasally infected female mice
with noninfected males. The CD4+V
Having demonstrated that adult mice
can be infected via the nasal route, we next tried to identify
the initial organized lymphoid organ infected by this retrovirus. We reasoned that if we could locate the site of the T
cell proliferation which occurs 4-6 d after MMTV infection, we would identify the lymphoid organ(s) in which
initial retroviral infection occurs. Indeed, after neonatal or
systemic MMTV infection, the SAg response is only found
in lymphoid tissues draining the site of MMTV infection:
the popliteal lymph node after footpad infection or the PP
during neonatal infection (2, 13). For this purpose, we nasally infected adult mice and killed them 6 d after infection.
We then determined the percentage of SAg-reactive T cells
in different lymphoid organs. We did not find any SAg-
reactive T cell proliferation in the PP, spleen, cervical
lymph nodes (upper or lower), mediastinal or brachial lymph
nodes, in the lymphoid cell population isolated from the lungs, or in peripheral blood (data not shown).
However, we did find an increase of the percentage of
SAg-reactive T cells in the lymphoid organ of the nasal
cavity (Fig. 3). A dilution of 1:8 of the same pool of infected milk did not induce an SAg response in NALT after
nasal infection, whereas dilutions up to 1:2,000 were still
able to induce proliferation of reactive T cells in the draining lymph node after footpad injection. This is probably
due to systemic infection being more efficient than nasal
infection. This result demonstrates that initial MMTV infection is localized at least in the nasal-associated lymphoid tissue.
To clearly demonstrate that
MMTV infection after nasal administration takes place in
the lymphoid organ of the nasal cavity, we analyzed by a
specific PCR whether viral DNA could be detected in the
lymphoid cells present in the nasal cavity. We isolated DNA from various lymphoid organs after 6 d, 8 d, 15 d, or
3 mo of infection and found that viral DNA is initially detected only in NALT and lung tissue (Fig. 4). At later time
points, we could find viral DNA in the peripheral lymph
nodes, PP, spleen, and thymus, showing that MMTV infection spread to all lymphoid organs as seen after systemic
and neonatal MMTV infection (Fig. 4).
We report that adult mice, like neonates, are susceptible
to mucosal MMTV infection. We show for the first time
that MMTV crosses the epithelium of the nasal cavity and
infects NALT.
After mucosal administration, whether intranasal for adult
mice or intraintestinal for neonates, the course of MMTV
infection is relatively similar in that the virus is first propagated in lymphoid tissue associated to the mucosal epithelium before disseminating to all lymphoid organs. At 10 d
of age, both the SAg response and the viral DNA are restricted to the PP of neonates, however, the viral DNA can
be detected in all lymphoid organs later (2). In adult mice,
the detection of the SAg response and viral DNA in the
NALT 6 d after nasal infection demonstrates that after crossing of the epithelium, MMTV infects this mucosal
lymphoid structure. The detection of viral DNA in cervical
lymph nodes, PP, thymus, and spleen and systemic SAgreactive T cell deletion shows that MMTV infection spread
to other lymphoid organs. Furthermore, nasal administration of MMTV-infected milk induces an efficient MMTV
infection, since the disease is transmitted to the offspring.
6 d after infection we could detect viral DNA in NALT
and in lung tissue, but the T cell proliferation characteristically induced by the SAg 4-6 d after MMTV infection was
not found in the lungs. This might be due to the procedure
used to isolate lymphoid cells from the lungs since we took
all the lung tissue and isolated the total pool of lymphoid
cells from it. It is therefore possible that the T cell proliferation only occurred in one or two lymphoid aggregates and
consequently was undetectable in the total pool of isolated
lymphoid cells. It is also possible that in the lungs, the cellular environment did not provide appropriate conditions
for the development of an SAg reaction (14). A very early
migration of infected lymphoid cells from the NALT to the lung could also account for the presence of viral DNA in
the lungs 6 d after nasal infection. Whatever the explanation, we showed that NALT is one of the initial site(s) of
viral spreading, since we could detect the SAg response and
viral DNA at this site. Furthermore, the lungs could be either an entry site for MMTV or an early site of migration
of infected cells derived from the NALT.
Adult mucosal MMTV infection seem to be less efficient
than the systemic infection. Indeed the number of MMTV
particles needed to induce an SAg response in NALT is
250-fold higher than the number necessary to induce the
SAg response in the popliteal lymph node after footpad injection. Similarly, we could observe that the quantity of
MMTV particles necessary to induce the deletion of the
SAg-reactive T cells from the peripheral blood after nasal infection is also higher than the number necessary after systemic infection (data not shown). The high quantity of
MMTV particles required for the successful infection of the
mucosae explains the relative resistance of adult mice to the
oral infection. Indeed, the acid conditions and digestive enzyme secretions of the adult gastrointestinal tract are likely
to inactivate the virus and consequently prevent PP infection. In support of this assumption, we could detect, 6 d after direct injection of infected milk in adult intestine, the
appearance of viral DNA in the PP (data not shown). The
large viral load necessary to infect mice by a mucosal surface is probably not restricted to the adult period of life. Indeed, neonates receive a tremendous load of viral particles throughout the nursing period (3).
Although we show that MMTV can cross the epithelium
of the nasal cavity, we have not elucidated how this process
occurs. Although many mechanisms can be postulated to
explain how a retrovirus can cross an epithelium to infect
the associated lymphoid structure, we favor two of them.
The first mechanism implicates M cell transport of MMTV
across the epithelium, since the epithelium of PP and NALT
contains M cells (6). This mechanism would allow direct access of MMTV to the lymphoid organ. In the second
mechanism, it might be possible that in the intestine, nasal,
or lung cavities, MMTV infects or is taken up by dendritic
cells associated with the epithelium (15, 16). The dendritic
cells infected or loaded with MMTV might then migrate to
draining lymph nodes and transmit the infection. These
postulated mechanisms of MMTV infection are not mutually exclusive and might be proven by the study of the kinetics of nasal infection of adult mice.
Another very important point to discuss in relation to
this study is the similarity between the putative modes of
mucosal infection of HIV-1 and MMTV. Epidemiologic
studies have revealed that worldwide, most HIV-1 infections are acquired by mucosal exposure (17). In adults, sexual transmission of HIV-1 can occur through unprotected
vaginal or anal intercourse (17). Oral infection is well documented in neonates, who can acquire the virus by breast feeding (18, 19). An epidemiologic study reported that unprotected receptive oral intercourse in adults should also be
viewed as high risk behavior for HIV-1 transmission (20).
Furthermore, studies of oral transmission of the simian immunodeficiency virus have shown that adult macaques after
nontraumatic oral exposure to cell-free simian immunodeficiency virus became infected and developed AIDS (21).
These findings suggest that the oral cavity is susceptible to
retroviral infections. In humans, the pharynx is guarded by
the Waldeyer's ring consisting of the tonsils and adenoid
lymphoid organs (22). Although mice do not have tonsils, their functional equivalent is the nasal-associated lymphoid
tissue (23). In this study, we observed that MMTV can infect lymphoid cells of NALT, which suggests that, as for
MMTV, HIV-1 might also infect the lymphoid cells of the
Waldeyer's ring. This assumption is corroborated by the
description of the presence of HIV-1 replication in the nasopharyngeal tonsil or adenoid of an infected individual (24).
In conclusion, this new adult model of mucosal MMTV
infection is a powerful tool to study the mechanisms of mucosal retroviral infection and to test candidate vaccines. We
are currently using this model to investigate the efficiency
of a systemic antibody response directed against MMTV to
prevent the early steps of mucosal infection.
domain, thereby providing T helper function
to infected B cells that in turn proliferate. These early cognate interactions between B and T cells facilitate the subsequent spread of MMTV to the mammary gland via lymphocytes (4).
6 (44-22-1; reference 9) or
anti-V
14 (14.2; reference 10). All samples were analyzed using a
FACScan® and the Lysys II program (Becton Dickinson). Dead
cells were excluded by a combination of forward and side scatter.
oligonucleotide, AGGTGGGTCACAATCAACGGC (MS10), is common to various endogenous MMTV (mtv)
orf sequences, and the 3
oligonucleotide, GCGACCCCCATGAGTATATTT (IM2), is specific for the SW orf sequence. After
5 min at 95°C, 1 min at 60°C, and 1 min at 72°C, followed by 30 cycles of 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C, the reaction
was terminated by an elongation of 10 min at 72°C. Specific
product was detected by liquid hybridization, with 10 µl of the
PCR reaction mixture being hybridized in 15 mM NaCl and
0.25 mM EDTA with 50 fmol of specific 32P-labeled internal
probe common to various mtv orf sequences MS11 (CAAGGAGGTCTAGCTCTGGCG). The conditions for denaturation and
hybridization were 5 min at 98°C, 15 min at 55°C, and a rapid
cooling to 4°C. 10 µl of reaction product was size separated on a
1.5% agarose gel, dried on paper (2589B; Schleicher and Schuell,
Dassel, Germany), and autoradiographed at
70°C overnight (12).
For controlling the quality and the quantity of the DNA samples, we
amplified of the endogenous orf sequences present in the BALB/c
genome. Oligonucleotides used were VJ77 (GATCGGATCCATGCCGCGCCTGCAGCAGA) and VJ71 (GTGTCGACCCAAACCAAGTCAGGAAACCACTTG). After 5 min at 95°C, 1 min at 60°C, and 1 min at 72°C, followed by 30 cycles of 30 s at
94°C, 30 s at 55°C, and 30 s at 72°C, the reaction was terminated by an elongation of 10 min at 72°C. The products were loaded
on 1.5% agarose gel and the specific band (1,200-bp) was visualized by ethidium bromide staining.
Adult Mice Can Be Infected by MMTV Via the Nasal
Route.
6+ T cells which are reactive to
the SAg molecule encoded by MMTV (SW). This deletion
was not observed in unmanipulated mice or mice inoculated intranasally with uninfected milk or PBS (Fig. 1). The
deletion kinetics of the SAg-reactive T cells observed after
nasal MMTV infection were slower than that observed after neonatal infection, probably reflecting a lower efficiency of nasal MMTV infection (Fig. 1). The same results
were obtained whether or not the mice were anesthetized
(data not shown). 5 mo after nasal infection, the CD4+
V
6+ T cells were deleted from blood, spleen, cervical lymph
nodes, and the nasal-associated lymphoid tissue. In comparison, the CD4+V
14+ T cells which are not reactive to the
SAg molecule encoded by MMTV (SW) were not deleted
(data not shown). These results demonstrate that MMTV
given by the nasal route was able to infect adult mice.
Fig. 1.
Clonal deletion of CD4+V
6+ T lymphocytes in peripheral
blood of BALB/c mice infected nasally with MMTV (SW). Mice were
anesthetized and received in the nostrils 20 µl of milk from infected (nine mice) or uninfected (seven mice) lactating females. As controls, seven
mice received 20 µl of PBS or were only anesthetized. As positive controls, the kinetics of deletion of the SAg-reactive T cell in mice infected
neonatally are shown (two mice). The indicated times are the number of
weeks after nasal MMTV infection or ages of mice infected during the
neonatal period.
[View Larger Version of this Image (69K GIF file)]
6+ T cell deletion
in the peripheral blood of the pups was determined in three
litters to monitor for disease transmission. Out of the six litters tested, five showed deletion of the SAg reactive T cells
(Fig. 2). These results clearly establish that adult female mice
infected nasally by MMTV (SW) transmit the disease to their offspring, indicating that MMTV (SW) does complete its
life cycle after adult nasal infection.
Fig. 2.
Female mice infected nasally by MMTV transmit the disease
to their offspring. Two mice were infected by the nasal route and mated
14 wk after infection. Blood was recovered from the pups of three litters
(1st, 2nd, 3rd) and the percentages of CD4+V
6+ T cells were determined by flow cytometry. The horizontal line represents percentages of
CD4+V
6+ T cells in peripheral blood of noninfected mice.
[View Larger Version of this Image (52K GIF file)]
Fig. 3.
T cell SAg response was found in the NALT. Adult mice
were infected by the nasal route (three mice) with 20 µl of infected milk
diluted to 1:2 or by injection in the footpad of 20 µl of the same infected
milk sample diluted to 1:1,000 or 1:2,000 (one mouse). After 5.5 d, mice
were killed and the percentages of V
6+ or V
14+ cells among CD4+ T
cells in NALT and cervical lymph nodes for the nasally infected mice or
in popliteal lymph nodes for the footpad-infected mice were determined
by flow cytometry. The horizontal line represents percentages of
CD4+V
6+ T cells of noninfected mice.
[View Larger Version of this Image (58K GIF file)]
Fig. 4.
MMTV (SW) viral DNA in different lymphoid organs after
nasal infection. Using a PCR assay, we amplified viral DNA sequences with oligonucleotides specific for MMTV (SW) SAg sequence (top) or
common to all endogenous MMTV (mtv) SAg sequences (bottom). The
latter PCR amplification experiments indicated that the quantities of genomic DNA taken from different lymphoid organs at the indicated times
points were comparable. DNA were isolated 6 d, 8 d, 15 d, or 3 mo after
nasal infection. LN, cervical lymph nodes.
[View Larger Version of this Image (24K GIF file)]
Address correspondence to Jean-Pierre Kraehenbuhl, Swiss Institute for Experimental Cancer Research, Ch1066 Epalinges, Switzerland.
Received for publication 16 January 1997 and in revised form 6 March 1997.
We would like to thank Hans Acha-Orbea for stimulating discussions, Sally Hopkins for the critical reading of the manuscript, and Monique Reinhardt for providing excellent technical help.
This work was supported by grants from the Swiss National Science Foundation (31-37612.93), the Swiss AIDS program (3139-37155.93), and the Swiss Research against Cancer Foundation (AKT 622).
| 1. |
Bittner, J.J..
1942.
The milk influence of breast tumors in
mice.
Science (Wash. DC).
95:
462-463
|
| 2. |
Karapetian, O.,
A.N. Shakhov,
J.P. Kraehenbuhl, and
H. Acha-Orbea.
1994.
Retroviral infection of neonatal Peyer's
Patch lymphocytes: the mouse mammary tumor virus model.
J. Exp. Med.
180:
1511-1516
|
| 3. |
Held, W.,
A.N. Shakhov,
S. Izui,
G. Waanders,
L. Scarpellino,
H.R. MacDonald, and
H. Acha-Orbea.
1993.
Superantigen reactive CD4+ T cells are required to stimulate B cells
after infection with mouse mammary tumor virus.
J. Exp.
Med.
177:
359-366
|
| 4. | Held, W., G. Waanders, A.N. Shakhov, L. Scarpellino, H. Acha-Orbea, and H.R. MacDonald. 1993. Superantigeninduced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission. Cell. 74: 529-540 [Medline]. |
| 5. |
Velin, D.,
H. Acha-Orbea, and
J.P. Kraehenbuhl.
1996.
The
neonatal Fc receptor is not required for mucosal infection of
mouse mammary tumor virus.
J. Virol.
70:
7250-7254
|
| 6. | Neutra, M.R., E. Pringault, and J.P. Kraehenbuhl. 1996. Antigen sampling across epithelial barriers and induction of mucosal immune responses. Annu. Rev. Immunol. 14: 275-300 [Medline]. |
| 7. | Neutra, M.R., A. Frey, and J.P. Kraehenbuhl. 1996. Epithelial M cells: gateways for mucosal infection and immunization. Cell. 86: 345-348 [Medline]. |
| 8. | Abraham, E., A.A. Freitas, and A.A. Coutinho. 1990. Purification and characterization of intraparenchymal lymphocytes. J. Immunol. 144: 2117-2122 [Abstract]. |
| 9. |
Payne, J.,
B.T. Huber,
N.A. Cannon,
R. Schneider,
M.W. Schilham,
H. Acha-Orbea,
H.R. MacDonald, and
H. Hengartner.
1988.
Two monoclonal rat antibodies with specificity for the beta-chain variable region V 6 of the murine T-cell
receptor.
Proc. Natl. Acad. Sci. USA.
85:
7695-7698
|
| 10. |
Liao, N.S.,
J. Maltzman, and
D.H. Raulet.
1989.
Positive selection determines T cell receptor V 14 gene usage by
CD8+ T cells.
J. Exp. Med.
170:
135-141
|
| 11. | Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 9.14-9.23. |
| 12. | Krummenacher, C., H. Diggelmann, and H. Acha-Orbea. 1996. In vivo effects of a recombinant vaccinia virus expressing a mouse mammary tumor virus superantigen. J. Virol. 70: 3026-3031 [Abstract]. |
| 13. | Acha-Orbea, H., and H.R. MacDonald. 1995. Superantigens of mouse mammary tumor virus. Annu. Rev. Immunol. 13: 459-486 [Medline]. |
| 14. | Upham, J.W., D.H. Strickland, N. Bilyk, B.W.S. Robinson, and P.G. Holt. 1995. Alveolar macrophages from humans and rodents selectively inhibit T-cell proliferation but permit T-cell activation and cytokine secretion. Immunology. 84: 142-147 [Medline]. |
| 15. | Maric, I., P.G. Holt, M.H. Perdue, and J. Bienenstock. 1996. Class II MHC antigen (Ia)-bearing dendritic cells in the epithelium of the rat intestine. J. Immunol. 156: 1408-1414 [Abstract]. |
| 16. | Holt, P.G., S. Haining, D.J. Nelson, and J.D. Sedgwik. 1994. Origin and steady state turnover of class II MHC-bearing dendritic cells in the epithelium of the conducting airways. J. Immunol. 153: 256-261 [Abstract]. |
| 17. | Chin, J.. 1990. Global estimates of AIDS and HIV infections. AIDS (Lond.). 4: S277-S283 . |
| 18. | Baba, T.W., J.E. Sampson, C. Fratazzi, M.F. Greene, and R.M. Ruprecht. 1993. Maternal transmission of the human immunodeficiency virus: can it be prevented? J. Women's Health. 2: 231-242 . |
| 19. | Gibb, D., and D. Wara. 1994. Paediatric HIV infection. AIDS (Lond.). 8: S275-S283 . |
| 20. |
Schacker, T.,
A.C. Collier,
J. Hughes,
T. Shea, and
L. Corey.
1996.
Clinical and epidemiologic features of primary HIV infection.
Ann. Intern. Med.
125:
257-261
|
| 21. | Baba, T.W., A.M. Trichel, V. Liska, L.N. Martin, M. Murphey-Corb, and R.M. Ruprecht. 1996. Infection and AIDS in adult macaques after nontraumatic oral exposure to cellfree SIV. Science (Wash. DC). 272: 1486-1489 [Abstract]. |
| 22. | Brandtzaeg, P., and T.S. Halstensen. 1992. Immunology and immunopathology of tonsils. Adv. Oto-rhino-laryngol. 47: 64-70 [Medline]. |
| 23. | Frieke, K.C., P.J. Koornstra, D.M.H. Hameleers, J. Biewenga, B.J. Spit, A.M. Duijvestijn, P.J.C. van Breda, Vriesman, and T. Sminia. 1992. The role of nasopharyngeal lymphoid tissue. Immunol. Today. 13: 219-224 [Medline]. |
| 24. | Frankel, S.S., B.M. Wenig, A.P. Burke, P. Mannan, L.D.R. Thompson, S.L. Abbondanzy, A.M. Nelson, M. Pope, and R.M. Steinman. 1996. Replication of HIV-1 in dendritic cell-derived syncytia at the mucosal surface of the adenoid. Science (Wash. DC). 272: 115-117 [Abstract]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|