|
||
R1
Regulation of the Transcriptional Activity of Elk-1 and
NFAT in Mast Cells
By
From the Lymphocyte Activation Laboratory, Imperial Cancer Research Fund, London WC2A 3PX, United Kingdom
Activation of Ras GTPases is a conserved feature of antigen receptor signaling, including
Fc
R1 activation of mast cells. Antigenic cross-linking of the Fc
R1 on mast cells results in secretion of allergic mediators and induction of immediate early and cytokine genes. Here we
examine the role of Ras in coupling the Fc
R1 to transcriptional regulation. The transcription
factors Elk-1, an immediate early gene regulator and the nuclear factor of activated T cells
(NFAT), in the context of the IL-4 gene, are identified as Ras targets in mast cells. Ras mediates diverse effects via its diverse effector pathways, which may include other members of the
Ras GTPase family such as RhoA and Rac-1. We observe that Elk-1 and NFAT are targeted
by distinct Ras effector pathways in mast cells. Activation of the "classical" Ras/Raf-1/MEK/
ERK cascade is necessary and sufficient for Fc
R1 induction of Elk-1. Ras function is required, but not sufficient for Fc
R1 induction of NFAT. However, activation or inhibition of
Ras markedly shifts the antigen dose-response for Fc
R1 induction of NFAT. The effector pathway for Ras activation of NFAT is not Raf-1/MEK. We identify that the Rac-1 GTPase
is critical in Fc
R1 regulation of NFAT, acting either in parallel with or as an effector of Ras.
These data place Ras in a crucial position in mast cells, regulating disparate nuclear targets.
Moreover, we identify that two GTPases, Ras and Rac-1, are important regulators of NFAT,
and therefore of cytokine expression in mast cells.
Antigenic cross-linking of the high affinity receptor for
IgE (Fc The Fc Our previous work has shown that in addition to Ca2+/
PKC signals, Fc It is recognized that Ras is able to activate multiple effector signaling pathways. An effector pathway mediated by the
Raf-1 serine/threonine kinase has been extensively characterized in numerous systems (12). Raf-1 is recruited to the
plasma membrane by active Ras.GTP. This recruitment results in Raf-1 activation and subsequent activation of the
mitogen-activated protein (MAP) kinases Erk1 and Erk2
by the Erk-activating kinases (MEKs). Like the B and T
cell antigen receptors, the Fc Previous studies have shown that Fc Reagents.
KLH-DNP conjugate, ionomycin calcium salt, CsA
and phorbol-12,13 dibutyrate were from Calbiochem (La Jolla,
CA). Monoclonal IgE anti-DNP was from Sigma Chemical Co.
(St. Louis, MO), as were all reagents for chloramphenicol acetyl
transferase (CAT) assays except 14C acetyl coenzyme A from Amersham International (Buckinghamshire, England). MEK inhibitor PD095089 was from New England Biolabs (Beverly, MA).
The PKC inhibitor Ro-318425 was a gift from Dr. David Williams (Roche Pharmaceuticals, Welwyn, UK). Anti-pan-Erk antibody was from Affiniti (UK).
Cell Culture and Stimulation.
The rat basophilic leukemia cell
line RBL2H3 as maintained in DMEM supplemented with 10%
(vol/vol) heat-inactivated (56°C for 30 min) fetal bovine serum.
Only the adherent fraction of the cell cultures was passaged or
used in experiments. Cells were detached from culture substrate
using cell scrapers, washed once, and primed with 1 µg/ml IgE
anti-DNP in DMEM, 10% fetal bovine serum for 2 h at 37°C.
Receptor cross-linking was effected using 500 ng/ml KLH-DNP
conjugate (Calbiochem) at 37°C. Other stimuli were applied as
follows: 50 ng/ml PdBu, 500 ng/ml ionomycin.
Western Blotting.
Conditions for RBL2H3 lysis and Western
blotting were as described previously (10). Briefly, postnuclear lysates were prepared, and cellular proteins were acetone precipitated and then resolved by 15% SDS-PAGE. Proteins were transferred to polyvinyl difluoride membrane which was blocked in 5%
nonfat milk for 1 h at room temperature before probing with 1 µg/ml anti-Erk (Affiniti). The membrane was washed three times
in PBS/0.02% Tween-20, and incubated with 0.5 µg/ml goat
anti-mouse horseradish peroxidase conjugate. After washing as
above, Erk bands were visualized by enhanced chemiluminescence (Amersham International).
Plasmids.
LexA OP.tk CAT comprises two copies of the
LexA reporter. In conjunction with the pEF-NLexA Elk-1C fusion protein, its use has already been described (28). This system
involves the transfection of a reporter gene construct of a LexA
binding site upstream of the CAT reporter gene under a thymidine kinase minimal promoter (LexA OP.tk CAT). A plasmid
encoding a fusion protein of the LexA DNA binding domain and
Elk-1 COOH-terminal region under a constitutive promoter is
cotransfected (pEF-NLexA Elk-1C). The LexA region of the fusion protein binds constitutively to its site on the reporter gene
construct. Activation signals phosphorylate the Elk-1C region of
the fusion protein, leading to recruitment of transcriptional machinery and CAT gene induction. The IL-4 NFAT CAT reporter
was a gift of E. Serfling (Wurzburg University, Wurzburg, Germany)
and comprised a trimerized NFAT/AP-1 site derived from purine
box B of the murine IL-4 promoter (GATCCTGAGTTTACATTGGAAAATTTTATAGAGCGAGTTG). Plasmids encoding
signaling proteins were as follows: pEF-BOSv-HaRas (constitutively
active V12Ras), RSVN17Ras (dominant inhibitory Ras), and pEFdnRaf-1 (dominant inhibitory Raf-1, Raf-1 residues 1-257). The
active pEF-V12Rac, dominant inhibitory pEF-N17Rac, and active pEF-V14Rho mutants have all been previously described (29).
The constitutively active membrane targeted pEF-Raf-1CAAX was a gift of J. Downward (Imperial Cancer Research Fund).
Plasmid DNA was prepared by CsCl density gradient centrifugation.
Transient Transfection Assays Using CAT Reporter Gene Constructs.
Transient transfection was carried out using a Beckman
Gene-Pulser electroporation apparatus. RBL2H3 monolayer cells
were detached from the culture flask using a cell scraper, and resuspended at 2 × 107 cells/0.6 ml DMEM + 10% FCS at 37°C.
Cell were pulsed in 0.4 cm cuvettes (Beckman) at 310 V, 960 µF
before pooling, dilution in complete medium, and division at 1 ml/
well between wells of a 24-well tissue culture plate. Cells were allowed to recover for 6 h at 37°C before priming and stimulation
as indicated.
R1) on mast cells results in expression of inflammatory function (1). In addition to the release of inflammatory mediators from cytoplasmic granules, there is a
significant nuclear component to the activation of mast
cells after Fc
R1 ligation. Expression of various genes is induced, notably leading to de novo synthesis of cytokines
such as IL-4, -6, GM-CSF, and TNF
(2).
R1 complex is tetrameric, comprised of 45-kD
and 30-kD
chains and a homodimer of two disulfidelinked 10-kD
chains (3). Antigenic cross-linking of receptor-bound IgE results in aggregation of Fc
R1 complexes
in the plane of the plasma membrane and rapid activation
of cytoplasmic protein tyrosine kinases (PTKs)1 (4). Immunoreceptor tyrosine-based activation motifs present in
Fc
R1
and
couple the receptor to the src family PTK
p56lyn and to p72syk (3). Fc
R1-associated PTKs activate a
number of effector pathways which together control mast cell
function. These include PLC
1 activation and subsequent
generation of inositol polyphosphate and diacylglycerol
second messengers (5, 6). These, in turn, modulate intracellular Ca2+ levels and protein kinase C (PKC) activation,
respectively. There are defined roles for Ca2+ and PKC signals in Fc
R1 regulation of exocytosis (7, 8), and a Ca2+/
calcineurin dependent pathway is known to be important
in the induction of a number of cytokine genes (2, 9).
R1-regulated PTKs are coupled to effector pathways via the adaptor molecule Grb2 (10). Grb2
forms protein complexes through interactions of its SH2
and SH3 domains with molecules which may be substrates
for receptor-associated PTKs (11). One Grb2 effector molecule in the mast cell is Sos, the mammalian homologue of
the Drosophila "Son of Sevenless" protein (10). Sos is a guanine nucleotide exchange factor that promotes GTP-loading, and hence activation of the GTPase Ras and its effector pathways. Studies in various systems have placed Ras
in a critical position regulating diverse cellular processes
through its regulation of kinase cascades with transcription
factor targets.
R1 activates the Ras/Raf-1/ Erk cascade, but its importance in antigen receptor signaling is not clear. Moreover, studies of the role of Ras in regulating fibroblast transformation have concluded that the
Raf-1/MEK pathway does not mediate all Ras effector
functions (13). Similarly, in T lymphocytes, the Raf-1/MEK
pathway has been shown to mediate Ras effects on positive
selection of thymocytes but apparently is not required for
Ras control of T cell proliferative responses (14). Alternative effectors for Ras are less defined than the "classical"
Raf-1/MEK/Erk cascade, but include the Ras GTPase activating proteins (Ras-GAPs) (15), PtdIns-3
hydroxyl kinase (16), and GDS proteins for the GTPase Ral (17).
There is also a consensus that Ras responses are coupled to
signaling networks mediated by Rho family GTPases such
as Rac-1, CDC42, and RhoA (18, 19). The role of these
Rho-family GTPases in antigen receptor responses is not
well characterized, but there is an increasing awareness
from both biochemical and genetic analyses that these molecules will have important functions in the immune system.
Vav, which is one of the immediate substrates for PTKs associated with antigen receptor complexes (20), has a domain homologous to Dbl, a guanine nucleotide exchange
factor for Rho family proteins (21). Recent studies have
shown that Vav can induce Rac-1-mediated activation of the
MAP kinase JNK-1 (22). In a clinical context, the WiskottAldrich Syndrome immunodeficiency has been mapped to a
defect in expression of an effector protein for the GTPase
CDC42 (23).
R1 induction of a
number of cytokine genes is sensitive to the imunosuppressive drug cyclosporin A (CsA) (24). The CsA sensitivity of
cytokine gene induction reflects the importance of the CsA
target molecule, the calcium dependent phosphatase calcineurin (CN), in this process. CN is critical for the regulation of the nuclear factor of activated T cells (NFAT), a
transcription factor involved in the regulation of various
cytokine genes (25, 26). In addition to the role of calcium/
CN, a previous report has shown that Ras signals link the
Fc
R1 to regulation of the IL-5 cytokine gene (27). However, there is no description of Ras effector pathways involved in coupling the Fc
R1 to nuclear events, or in determining the repertoire of such targets for Ras signals. The
present report identifies the transcription factors Elk-1 and
NFAT as targets for Ras signals in mast cells. Moreover, we
explore the Ras effector pathways used to link the Fc
R1
to these targets. The data show that the Fc
R1 regulates
Elk-1 transactivation via a Ras/MEK-dependent pathway.
The Fc
R1 activation of Elk-1, described herein for Fc
R1 signaling, provides the paradigm for involvement of the
"classical" Ras/Raf-1/MEK cascade in coupling antigen
receptors to gene transcription. We also show that NFAT
in the context of the IL-4 promoter is another nuclear target for Ras signals downstream of the Fc
R1. However, in
contrast to Elk-1, Fc
R1 regulation of NFAT is accomplished by an effector pathway for Ras distinct from Raf-1/
MEK. The present study also provides the first evidence
that a member of the Rho family of GTPases, Rac-1, can
regulate Fc
R1 induction of NFAT. These data reveal the
complexity and efficacy of Ras and Rho family GTPases in
coupling antigen receptors to diverse nuclear events.
R1 and Phorbol
Esters, But Not by the Action of Calcium Ionophore.
The effects of various stimuli on Elk-1 activity in mast cells were
assessed using a CAT reporter gene assay for Elk-1 transactivation. The data in Fig. 1 a shows that antigenic cross-linking
of the Fc
R1 using KLH-DNP strongly induces Elk-1
transactivation in a dose-dependent manner. In addition,
the phorbol ester PdBu that directly activates PKC, induces
ninefold induction of Elk-1 transactivation over basal levels. Fig. 1 a also shows that elevation of intracellular calcium levels using the ionophore Ionomycin is not sufficient for Elk-1 activation. Stimulation by Fc
R1 or the phorbol
ester PdBu does not induce LexA OPtk.CAT activity in
the absence of a coexpressed LexA Elk-1C fusion protein
(Fig. 1 b).
R1 activation stimulates Elk-1 transactivation in mast
cells. 12 µg LexA OPtk.CAT and 6 µg LexA Elk-1C plasmids were used
per 1 × 107 cells in electroporation at 310 V/960 µF. Cells were recovered as described in Materials and Methods before stimulation for 16 h
with PdBu (50 ng/ml), Ionomycin (500 ng/ml) alone or in combination (P+I), or IgE priming followed by antigenic cross-linking of the Fc
R1
with the indicated dose of KLH-DNP. Control cells (NS) were left unstimulated. (b) Stimulation of LexA OP.tk CAT activity is dependent on
the presence of the LexA Elk-1C fusion protein. 1 × 107 cells per stimulus were electroporated as described with 12 µg LexA OPtk.CAT alone
or in combination with 6 µg LexA Elk-1C. Cells were recovered, and
then stimulated for 16 h as described above. (c) Fc
R1 activation of Elk-1
is not PKC-dependent. Cells were transfected with the Elk-1 reporter
system as described, and recovered for 6 h. Preincubation with either 1 µM Ro-318425 or DMSO carrier was 30 min at 37°C before stimulation
with either PdBu (50 ng/ml) or KLH-DNP (250 ng/ml).
Fc
R1 ligation is known to activate PKC, and previous
studies have established that PKC mediated signals are important for Fc
R1 induction of mast cell degranulation.
PKC activation is therefore a candidate mechanism for
Fc
R1 induction of Elk-1. We used a broad-spectrum inhibitor of PKC isozymes, Ro-318425 (30), to assay the
contribution of PKC to Elk-1 induction by the Fc
R1.
Ro-318425 inhibits the activity of the major PKC isozymes shown to translocate to the plasma membrane following Fc
R1 ligation. The data in Fig. 1 c show that a 500 nM dose of Ro-318425 inhibits PdBu activation of Elk-1
by 85%. In contrast, Fc
R1 stimulation can potently induce Elk-1 transactivation, despite the presence of Ro318425.
The data in Fig. 1 a demonstrate that signals derived from
the Fc
R1 regulate the transcriptional activity of Elk-1.
The insensitivity of Fc
R1 stimulation of Elk-1 to the
PKC inhibitor Ro-318425 suggests that PKC-mediated
signals are not essential for Elk-1 regulation by the Fc
R1.
Raising of intracellular calcium levels by ionomycin treatment or the mimicking of this effect by the cotransfection of an activated mutant of the calcium-dependent phosphatase calcineurin (data not shown) did not induce Elk-1
activity. Hence, we investigated candidate noncalcium/
PKC pathways for Elk-1 activation.
Elk-1 could be a target for a kinase cascade initiated by Ras. The prototypical kinase cascade transducing Ras signals is the Raf-1/MEK/ Erk pathway, and there is a precedent for Elk-1 activation via this mechanism in the fibroblast (31). To explore the role of Ras and Raf-1 signals in Elk-1 activation in mast cells, we examined the effects of activated Ras and Raf-1 mutants on Elk-1 activity in mast cells. The Raf-1 construct used here is a fusion protein of Raf-1 with a CAAX box motif that targets Raf-1 to the plasma membrane, rendering the exogenously expressed Raf-1 constitutively active (32). In these experiments, plasmids bearing the indicated mutants were cotransfected with the LexA Elk-1C fusion protein expression plasmid and the LexA OP.tkCAT reporter gene. The data in Fig. 2 a show that activated forms of both Ras and a Ras effector, Raf-1, are capable of inducing Elk-1 transactivation in RBL2H3 cells in the absence of other stimuli.
R1 activation of Elk-1 is dependent on Ras. 1 × 107 cells per
point were transfected with either the Elk-1 reporter system alone (control), or in combination with 15 µg of either RSV N17Ras or pEF dn
Raf-1. Cells were recovered and left unstimulated (NS) or exposed to
IgE/KLH-DNP as described.
In additional experiments we investigated whether Fc
R1
induction of Elk-1 is dependent on the activation of a Ras
cascade using dominant inhibitory mutants. The N17 mutant of Ras acts to sequester guanine nucleotide exchange
factors from endogenous pools of the GTPase, and maintains Ras in its GDP-bound, inactive state. The dominant
inhibitory (dn) Raf-1 mutant has the COOH-terminal kinase domain truncated; this mutant binds to activated
Ras.GTP and prevents its interaction with effector proteins. Figs. 2 b and c show the effect of dn mutants of Ras
and Raf-1 on Fc
R1 induction of Elk-1 transactivation.
Fc
R1 induction of Elk-1 activity is inhibited by expression of either N17Ras or dnRaf-1, in a manner that is dose
dependent on the amount of dominant negative plasmid used for cotransfection. At 20 µg cotransfected N17Ras or
dnRaf-1, the percentage inhibitions of Fc
R1 induction of
Elk-1 transactivation were 74 and 79%, respectively. The
sensitivity of Fc
R1 induction of Elk-1 to dominant inhibitory mutants of both Ras and Raf-1 suggests that the
"classical" pathway for MAP kinase stimulation is involved in
Elk-1 activation in RBL2H3 cells. In this pathway, Ras.GTP
induces membrane targeting and activation of Raf-1, that acts subsequently on Erk members of the MAP kinase family via the Erk-activating kinase MEK. However, the dn
Raf-1 mutant not only prevents interactions between activated Ras and endogenous Raf-1, but also blocks Ras
binding to other effector molecules. Thus, to explore the
role of the MEK/Erk2 pathway in Elk-1 regulation more
directly, we used PD098059, an inhibitor of the Erk2 stimulatory kinase, the MAP kinase kinase MEK.
The specificity of PD098059 as a MEK inhibitor has
been previously described (33). Nevertheless, in initial experiments we verified that PD098059 was an effective
MEK inhibitor in RBL2H3 cells. The phosphorylation of
Erk by MEK results in decreased electrophoretic mobility
of Erk in SDS-PAGE. Fig. 3 a shows an Erk mobility shift
assay visualized by pan-Erk Western blot. In control cells
(left), PdBu or Fc
R1 stimulation cause the appearance of
an hyperphosphorylated Erk population. The application of
25 µM PD098059 (right) efficiently inhibits the activation
of Erk by MEK in mast cells. Accordingly, we examined
the effect of PD098059 on induction of Elk-1 transactivation in mast cells. As shown in Fig. 3 b, the activation of
Elk-1 induced by cotransfection of Raf-CAAX and V12Ras
constructs is inhibited by PD098059. Hence, these mutants
are indeed reflecting the use of a Raf-1/Erk pathway to
target Elk-1. Fig. 3 c shows that the induction of Elk-1
transactivation by both PdBu and Fc
R1 cross-linking is
inhibited by PD098059 in a dose-dependent manner. These
data confirm that the Raf-1/MEK cascade is the critical
Ras effector pathway for Fc
R1 activation of Elk-1.
R1 or
PdBu is sensitive to inhibition of MEK. 1 × 107 cells per point were
transfected with the Elk-1 reporter system and recovered for 6 h. Cells
were preincubated for 30 min with either DMSO or the indicated concentrations of PD098059. Cells were left unstimulated (NS), exposed to
IgE/KLH-DNP, or PdBu as described.
NFAT Is a Target for a Ras Effector Pathways Distinct from Raf-1/MEK in the Mast Cell.
Fc
R1 stimulation results in
the activation of cytokine genes, the products of which
play important roles both locally in inflammation and systemically. Transcription factors of the NFAT family are
important for cytokine gene induction in a variety of cells
and a well characterized target for NFAT family proteins in
an activated mast cell is the gene for IL-4 (25). Fc
R1 triggering has been shown to induce NFAT DNA binding activity (26), and we investigated Fc
R1 mechanisms for
NFAT induction in mast cells using a reporter construct
comprising a trimerized NFAT site derived from the murine IL-4 promoter.
Fig. 4 a shows that Fc
R1 cross-linking induces IL-4
NFAT activity in a manner dose dependent on antigen.
The PKC inhibitor Ro-318425 did not affect the Fc
R1
activation of NFAT (data not shown). To address whether
there is a role for Ras in the Fc
R1 regulation of NFAT,
we cotransfected active and dominant inhibitory Ras mutants with the IL-4 NFAT-CAT reporter gene. Expression of active V12Ras induced a weak increase in the basal
activity of the NFAT reporter gene, and robustly potentiated Fc
R1 induction of NFAT. Conversely, expression of
N17Ras inhibited the NFAT response to Fc
R1 (Fig. 4 b).
Hence, cotransfected activated Ras (V12Ras) causes a potentiation of Fc
R1 activation of IL-4 NFAT that potently increases the sensitivity of NFAT responses to antigen. The
presence of N17Ras consistently inhibits the antigen dose
response for IL-4 NFAT CAT induction to half-maximal
levels, and supresses the antigen sensitivity of the mast cells
for NFAT activation.
R1 cross-linking induces IL-4 NFAT CAT activity in
a dose-dependent manner. 1 × 107 cells per point were transfected with
15 µg IL-4 NFAT CAT reporter. Cells were recovered for 6 h before
IgE priming and stimulation with the indicated concentrations of KLHDNP. (b) Fc
R1 stimulation of IL-4 NFAT is potentiated by active
V12Ras, but not Raf-CAAX, and is inhibited by the presence of dominant negative N17Ras. 1 × 107 cells per point were transfected with 15 µg
IL-4 NFAT CAT reporter alone (solid line, filled squares), or in combination with 15 µg active V12Ras (solid line, open circles), 15 µg dominant inhibitory N17Ras (broken line, filled diamonds), or 15 µg Raf-CAAX (broken line, open triangles). Cells were recovered for 6 h before IgE priming, and then
stimulation with the indicated concentrations of KLH-DNP. (c) Fc
R1
stimulation of IL-4 NFAT CAT activity is insensitive to PD098059. 1 × 107 cells per point were transfected with 15 µg IL-4 NFAT CAT reporter alone, and recovered for 6 h. Cells were preincubated for 30 min with either DMSO or the indicated concentrations of PD098059. Cells were left
unstimulated (NS), exposed to IgE/KLH-DNP, or treated with 50 ng/ml
PdBu and 500 ng/ml ionomycin.
Raf-1 was a key effector for activation of Elk-1 in mast
cells and expression of membrane targeted, and hence
active, Raf-1 (Raf-CAAX) could mimic the effects of
V12Ras and potently stimulate Elk-1 transcriptional activity. However, Fig. 4 b shows that expression of Raf-CAAX
cannot substitute for V12Ras to induce NFAT transcriptional activity. These data prompted us to investigate the
effect of inhibiting the Raf-1/MEK pathway using PD098059
on NFAT transcriptional activity. Fig. 4 c shows that the
activation of IL-4 NFAT CAT by the Fc
R1 is insensitive
to the application of PD098059. Hence, in contrast to Elk-1,
the critical Ras effector pathway for NFAT regulation in
mast cells cannot be Raf-1/Erk.
R1 Stimulation in Mast Cells.
The Rho family GTPase Rac-1 has been shown to play a role in Ras
regulation of fibroblast transformation (19) and in T cell antigen receptor regulation of NFAT (34). We therefore
investigated the effects of Rho family GTPases in Fc
R1
signaling to NFAT. Active mutants of Rac-1 and Rho
(V12Rac and V14Rho, respectively) were used to assay
whether these GTPases can regulate IL-4 NFAT activation
in the mast cell. Fig. 5 a shows that expression of the active
V12Rac mutant induced an increase in the basal activity of
the NFAT reporter gene, and highly potentiated the
Fc
R1 activation of IL-4 NFAT. To demonstrate the specificity of this effect, we showed that an activated V14Rho
had no discernable potentiating effect on IL-4 NFAT induction (Fig. 5 a).
R1 stimulation of IL-4 NFAT is potentiated by active
V12Rac, and is inhibited by the presence of dominant negative N17Rac.
1 × 107 cells per point were transfected with 15 µg IL-4 NFAT CAT reporter alone (solid line, filled squares), or in combination with 15 µg active
V12Rac (broken line, filled diamonds), 15 µg dominant inhibitory N17Rac
(solid line, open circles), or 15 µg active V14Rho (broken line, open triangles).
Cells were recovered for 6 h before IgE priming and stimulation with the
indicated concentrations of KLH-DNP. (b) Fc
R1 stimulation of Elk-1
activity, a Raf-1/MEK-dependent process, is insensitive to N17Rac expression. 1 × 107 cells per point were transfected with either the Elk-1 reporter system alone (control), or in combination with 15 µg of pEFN17Rac. Cells were recovered and left unstimulated (NS), or exposed to IgE/
KLH-DNP as described. (c) Stimulation of NFAT by the Fc
R1 alone or
in concert with V12Rac is sensitive to CsA. 1 × 107 cells per point were
transfected with 15 µg IL-4 NFAT CAT reporter alone (solid line, open
squares), or in combination with 15 µg active V12Rac (broken line, filled diamonds). Cells were recovered, primed with IgE anti-DNP, and preincubated for 30 min with either vehicle (control) or the indicated dose of CsA
before Fc
R1 stimulation as described.
The ability of active Rac-1 to potentiate Fc
R1/NFAT
responses shows that this GTPase has the potential to regulate NFAT activity in mast cells. To examine whether
Rac-1 actually plays a role in the NFAT response to Fc
R1
stimulation, we cotransfected the NFAT reporter gene
with an inhibitory mutant of Rac-1, N17Rac. The data in
Fig. 5 a show that expression of N17Rac had a marked inhibitory effect on Fc
R1 induction of NFAT. As a specificity control, we examined the effect of N17Rac on
Fc
R1 activation of Elk-1 transcription. Fig. 5 b shows that
Fc
R1 induction of Elk-1 is insensitive to the presence of
N17Rac; therefore, we have demonstrated a specific requirement for Rac-1 activity in Fc
R1 regulation of NFAT.
Induction of NFAT trancriptional activity in mast cells is
dependent on the calcium/calcineurin pathway, and is
therefore sensitive to inhibition via the immunosuppressive
drug CsA (25). The data in Fig. 5 c show that the Fc
R1
induction of NFAT is also sensitive to the action of CsA in
a dose-dependent manner. Expression of the activated
V12Rac mutant, which potentiates Fc
R1 induction of
NFAT, was unable to reverse the inhibition of the response
observed with CsA. These data indicate that Fc
R1 induction of NFAT requires at least the convergent action of
Rac and CN pathways.
The data herein show that the Fc
R1 activation of Ras
and its effector pathways allow receptor regulation of the
transcription factors Elk-1 and NFAT. The diversity of its
effector pathways enables Ras to act in a critical position to
direct activation of various nuclear targets. We have shown
that Ras signals are thus necessary and sufficient for Fc
R1
transcriptional activation of Elk-1, a transcription factor
important in the context of the serum response element
which is a regulatory component of immediate early gene
promoters (31). Ras signals also play a role in Fc
R1 regulation of NFAT complexes, although they are not sufficent for this response. In this report we have also identified
NFAT as a target for Rac-1 signaling pathways in mast
cells. Expression of active Rac-1 protein dramatically potentiates Fc
R1 induction of NFAT, whereas expression of
an inhibitory Rac-1 mutant severely abrogates the NFAT
response to Fc
R1 stimulation. These data place the GTPases Ras and Rac-1 in a critical position regulating the nuclear component of mast cell end function.
The SRE is responsible for regulation of immediate early
genes such as c-fos and egr-1, and has been shown to be a
convergence point for varied signaling pathways including
the Ras/MEK pathway in fibroblasts (35, 28). Extensive
studies have shown that transcriptional activation of Elk-1
is dependent on its COOH-terminal phosphorylation by
members of the MAP kinase family such as Erk-1/2, the
Jun (stress-activated) kinase JNK, and the p38 kinase (28, 36). Despite the potential for Elk-1 to be targeted by multiple MAP kinases, the data herein show that the Ras effector pathway involved in Fc
R1 regulation of Elk-1 absolutely requires the activity of the Erk-activating kinase
MEK, acting downstream of Ras and its effector Raf-1.
These data show that the Ras/Raf-1/MEK pathway has a
dominant role in Fc
R1 regulation of Elk-1, reflecting clear parallels between Elk-1 activation following antigen
receptor ligation and growth factor stimulation of fibroblasts.
NFAT family members form regulatory complexes which
bind cytokine gene promoters (37). Initially described as
critical for IL-2 production in T cells, NFAT has also been
implicated in transcriptional activation of the genes for IL-4,
GM-CSF, and TNF
. NFAT comprises a cytoplasmic
component which translocates to the nuclei of stimulated cells and complexes with an inducible nuclear component.
The former component is encoded by an extensive gene
family including NFATp, NFATc, NFAT-3, and NFAT-4/x.
The latter is composed of AP-1 family members, e.g., Fos/Jun.
NFATp is a crucial transcription factor for regulation of the
IL-4 gene in the T cell (38), and is implicated in transcriptional activation of the IL-4 gene in mast cells (25). IL-4
produced by mast cells after Fc
R1 cross-linking is thought to play an important role in the generation of a sustained
inflammatory response. Locally, a pulse of mast cell IL-4
stimulates T cells into sustained IL-4 production and subsequent inflammatory cell infiltration. By feeding back on B
cells to promote antigen specific IgE production, mast cell-
derived IL-4 contributes to the sustained responsiveness of
mast cells themselves to antigen/allergen.
Previous studies in T cells have shown that transcriptional activity of the NFAT complex required for IL-2
gene induction is dependent on the concerted action of
Ras and calcium/calcineurin signaling pathways (39). Moreover, previous data from our laboratory has shown that
multiple Ras effector pathways converge on NFAT in the
context of the IL-2 promoter (34). The Raf-1/MEK pathway is one component of TCR induction of NFAT, but
there is also a contribution from signals regulated by the
GTPase Rac-1 (34). In the context of the activated mast
cell, one target for NFAT is the IL-4 gene promoter. We
have found that Ras signals are an absolute requirement for
Fc
R1 regulation of a reporter construct driven by a region
of the IL-4 promoter 270 base pairs upstream of the transcriptional start site (Turner, H., and D.A. Cantrell, unpublished observation). The clear implication of this finding is
that the IL-4 promoter contains targets for Ras signaling
pathways, one of which we establish as NFAT.
Calcium/calcineurin signals are known to be critical for
NFAT responses; IL-4 NFAT CAT activity can be strongly
induced by an activated mutant of calcineurin or by ionophore treatment (Turner, H., and D.A. Cantrell, unpublished observations). The role of calcium signals in NFAT
regulation in the T cell is to induce nuclear translocation of
NFAT protein (37, 40, 41). The present data show that in
addition to a requirement for calcium/calcineurin, Ras and
Rac-1 signaling pathways are important for Fc
R1 induction of IL-4 NFAT. While expression of activated Ras
could potentiate Fc
R1 induction of NFAT, this effect
could not be mimicked by stimulation of the Raf-1/MEK
pathway using Raf-CAAX. Furthermore, inhibition of
MEK/Erk2 activity does not affect Fc
R1 activation of
NFAT. Hence, we are able to exclude the "classical" Ras/
Raf-1/MEK cascade. In comparison with the data in the T
cell system, we also observe in mast cells that NFAT integrates multiple signals. In the mast cell, as in the T cell,
there is a requirement for both calcium/calcineurin and
Rac-1 signals in antigen receptor regulation of NFAT.
However, the nature of the Ras signal, which is also required, differs between the two systems. In the mast cell,
there is no requirement for Raf-1/MEK activity, while in the T cell, NFAT is regulated by this and another uncharacterized Ras effector pathway (34).
It is recognized that certain cellular responses to Ras require the activity of other GTPases; notably, Ras mediated transformation of fibroblasts requires signaling pathways mediated by Rac-1 and RhoA (18, 19). The data herein show that IL-4 NFAT activation in mast cells requires the function of Rac-1. The recognition that Rac-1 may play a pivotal role in NFAT responses raises the issue of the identity of Rac-1 effector pathways in mast cells. Proteins that can bind directly to GTP-bound active Rac-1 include members of the p21-associated kinase serine/threonine kinase family (42) and the ribosomal p70S6 kinase (43). Rac-1 has also been shown to activate the MAP kinase family members JNK-1 and p38 (44), making these candidate kinases for transduction of the Rac-1 signal leading to NFAT activation in mast cells.
There is an inhibitor of the p38 kinase available SB203580
(45) which does not modulate NFAT responses to Fc
R1
activation (Turner, H., and D.A. Cantrell, unpublished observations). The immunosupressant Rapamycin which inhibits p70S6 kinase also does not inhibit NFAT activation,
excluding a role for this kinase in NFAT responses. Hence,
it is unlikely that these enzymes are responsible for Rac-1
activation of NFAT. We have observed in preliminary experiments that the Fc
R1 activates the MAP kinase JNK-1
(Turner, H., and D.A. Cantrell, unpublished observation, and P. Bauer, personal communication). However, there
are no small molecule inhibitors of JNK-1 pathways analogous to the PD098059 MEK inhibitor or the SB203580
p38 inhibitor that can be used to probe the cellular role of
JNK-1 in NFAT responses. Therefore, the role of Rac-1 in
coupling the Fc
R1 to JNK-1 has yet to be examined.
Moreover, JNK-1 is by no means the sole remaining candidate for a Rac-1 effector after the elimination of ERK, p38
and p70S6 kinase. There is now a burgeoning body of
work on novel Rac-1 effectors including members of the
p21-associated kinase family and the cytoskeletal regulatory
protein POR-1 (42, 46).
The requirement for both Ras and Rac-1 function for
Fc
R1 activation of NFAT in mast cells is consistent with a
model where Rac-1 is part of a separate Fc
R1 signaling
pathway that converges with Ras signals on IL-4 NFAT
to fully activate the transcription factor complex. Nevertheless, it is equally possible to envisage a mechanism in
which Rac-1 acts as a downstream effector for Ras. For
example, Vav is a putative Rac-1/RhoA guanine nucleotide exchange protein (21) that is tyrosine phosphorylated
in response to Fc
R1 ligation (20), and is able to stimulate
Rac-1-mediated JNK-1 activation in fibroblasts (22). Vav
would thus be a candidate molecule for coupling the Fc
R1
to Rac-1 responses. This model is analogous to the links
between Ras and Rac-1 that have been documented in fibroblasts where Rac-1 couples Ras to the signaling pathways
that control rearrangements of the actin cytoskeleton (47).
It is difficult to resolve these various possibilities (summarized in Fig. 6), and they are not mutually exclusive; Ras
and Rac-1 may integrate signals from multiple inputs in the
mast cell. This may be true both in terms of multiple intracellular signals generated by antigen receptor ligation, and
in terms of reactivity to different extracellular stimuli. Certainly, Ras is not only activated by antigen receptor triggering in mast cells, but can be activated by cytokines such as
IL-3 and GM-CSF (48). Activation of Ras-stimulatory
pathways by integrins, which are likely to be involved in
mast cell adherence to a tissue substratum, has also been
documented (49). It is reasonable to expect that during the
early course of an inflammatory response, mast cells would be exposed to Ras-activating cytokines such as IL-3 and
GM-CSF produced by antigen activated T cells. The effect
of Ras activation on IL-4 NFAT activity is essentially that
of altering the antigen receptor dose response threshold.
Hence, exposure of mast cells to Ras-activating cytokines
can be viewed as an important priming step which increases
the responsiveness of mast cells to a given antigen dose.
R1 action on transcription factor
targets in mast cells. Ras signals through the Raf-1/MEK pathway are
necessary and sufficient for Elk-1 activation. In contrast, the NFAT complex integrates multiple signals from the Fc
R1. Calcium signals induce nuclear translocation of NFAT protein. Ras and Rac-1 GTPases are also implicated in Fc
R1 activation of NFAT, acting either in parallel or in series.
Address correspondence to Doreen A. Cantrell, Lymphocyte Activation Laboratory, Imperial Cancer Research Fund, PO Box 123, Lincoln's Inn Fields, London WC2A 3PX, UK.
Received for publication 29 August 1996
For gifts of constructs we thank E. Serfling for the IL-4 NFAT reporter and Dr. Richard Treisman for the Elk-1 reporter system. Also, we thank members of the Lymphocyte Activation Laboratory for valuable advice and discussions of the manuscript.| 1. | Metzger, H.. 1992. The receptor with high affinity for IgE. Immunol. Rev 125: 37-48 [Medline] . |
| 2. | Plaut, M., J.H. Pierce, C.J. Watson, J. Hanley, Hyde, R.P. Nordan, and W.E. Paul. 1989. Mast cell lines produce lymphokines in response to cross-linkage of Fc epsilon RI or to calcium ionophores. Nature (Lond.). 339: 64-67 [Medline] . |
| 3. | Jouvin, M.H., R.P. Numerof, and J.P. Kinet. 1995. Signal transduction through the conserved motifs of the high affinity IgE receptor Fc epsilon RI. Semin. Immunol. 7: 29-35 [Medline] . |
| 4. | Eiseman, E., and J.B. Bolen. 1992. Engagement of the high affinity IgE receptor activates src protein related tyrosine kinases. Nature (Lond.). 355: 78-80 [Medline] . |
| 5. |
Park, D.J.,
H.K. Min, and
S.G. Rhee.
1991.
IgE induced tyrosine phosphorylation of phospholipase C- 1 in rat basophilic leukaemia cells.
J. Biol. Chem.
266:
24237-24240
|
| 6. |
Li, W.,
G.G. Deanin,
B. Margolis,
J. Schlessinger, and
J.M. Oliver.
1992.
Fc R1 mediated tyrosine phosphorylation of
multiple proteins including phopsholipase C 1 and the receptor ![]() 2 complex, in rat basophilic leukemia cells.
Mol.
Cell Biol.
12:
3176-3182
|
| 7. |
Ozawa, K.,
Z. Szallis,
M.G. Kazanietz,
P.M. Blumberg,
H. Mischak,
J.F. Mushinski, and
M.A. Beaven.
1993.
Ca dependent and independent isozymes of protein kinase C mediate
exocytosis in antigen stimulated rat basophilic RBL2H3 cells.
J. Biol. Chem.
268:
1749-1756
|
| 8. | Buccione, R., G. Di Tullio, M. Caretta, M. Marinetti, C. Bizzarri, S. Francavilla, A. Luini, and M.A. De Matteis. 1994. Analysis of protein kinase C requirement for exocytosis in permeabilised rat basophilic leukemia RBL2H3 cells: a GTP binding protein(s) as a potential target for protein kinase C. Biochem. J. 298: 149-156 . |
| 9. |
Wodnar Filipowicz, A., and C. Moroni.
1990.
Regulation of
interleukin 3 mRNA expression in mast cells occurs at the
posttranscriptional level and is mediated by calcium ions.
Proc. Natl. Acad. Sci. USA.
87:
777-781
|
| 10. |
Turner, H.,
K. Reif,
J. Rivera, and
D.A. Cantrell.
1995.
Regulation of the adapter molecule Grb2 by the FceR1 in
the mast cell line RBL2H3.
J. Biol. Chem.
270:
9500-9506
|
| 11. | Boguski, M.S., and F. McCormick. 1993. Proteins regulating Ras and its relatives. Nature (Lond.). 366: 643-654 [Medline] . |
| 12. | Marshall, C.J.. 1994. MAP kinase kinase kinase, MAP kinase kinase, and MAP kinase. Curr. Opin. Genet. Dev. 4: 82-89 [Medline] . |
| 13. | White, M., C. Nicolette, A. Minden, A. Polverino, L. Van Aelst, M. Karin, and M. Wigler. 1995. Multiple Ras functions can contribute to mammalian cell transformation. Cell. 80: 533-541 [Medline] . |
| 14. | Alberola-Ila, J., K.A. Forbush, R. Seger, E.G. Krebs, and R.M. Perlmutter. 1995. Selective requirement for MAP kinase activation in thymocyte differentiation. Nature (Lond.). 373: 620-623 [Medline] . |
| 15. | Downward, J.. 1992. Regulation of p21ras by GAPs and guanine nucleotide exchange proteins in normal and oncogenic cells. Curr. Opin. Genet. Dev. 2: 13-18 [Medline] . |
| 16. | Rodriguez-Viciana, P., P.H. Warne, R. Dhand, B. Vanhaesbroeck, I. Gout, M.J. Fry, M.D. Waterfield, and J. Downward. 1994. Phosphatidylinositol-3-OH kinase as a direct target of Ras. Nature (Lond.). 370: 527-532 [Medline] . |
| 17. |
Hofer, F.,
S. Fields,
C. Schneider, and
G.S. Martin.
1994.
Activated Ras interacts with the Ral guanine nucleotide dissociation stimulator.
Proc. Natl. Acad. Sci. USA.
91:
11089-11093
|
| 18. | Prendergast, G.C., R. Khosravi, Far, P.A. Solski, H. Kurzawa, P.F. Lebowitz, and C.J. Der. 1995. Critical role of Rho in cell transformation by oncogenic Ras. Oncogene. 10: 2289-2296 [Medline] . |
| 19. | Qiu, R.G., J. Chen, D. Kirn, F. McCormick, and M. Symons. 1995. An essential role for Rac in Ras transformation. Nature (Lond.). 374: 457-459 [Medline] . |
| 20. | Margolis, B., P. Hu, S. Katzav, W. Li, J.M. Oliver, A. Ullrich, A. Weiss, and J. Schlessinger. 1992. Tyrosine phosphorylation of vav proto-oncogene product containing SH2 domain and transcription factor motifs. Nature (Lond.). 356: 71-74 [Medline] . |
| 21. | Quilliam, L.A., R. Khosravi, Far, S.Y. Huff, and C.J. Der. 1995. Guanine nucleotide exchange factors: activators of the Ras superfamily of proteins. Bioessays. 17: 395-404 [Medline] . |
| 22. | Crespo, P., X. Bustelo, D. Aaronsen, O. Coso, M. Barahona, M. Barbacid, and J. Gutkind. 1996. Rac-1 dependent stimulation of the JNK/SAPK signaling pathway by Vav. Oncogene. 13: 455-460 [Medline] . |
| 23. | Symons, M., J.M. Derry, B. Karlak, S. Jiang, V. Lemahieu, F. McCormick, U. Francke, and A. Abo. 1996. Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, is implicated in actin polymerization. Cell. 84: 723-734 [Medline] . |
| 24. |
Kaye, R.,
D. Fruman,
B. Bierer,
M. Albers,
L. Zydowski,
S. Ho,
Y. Jin,
M. Castells,
S. Schreiber,
C. Walsh,
S. Burakoff,
K. Austen, and
H. Katz.
1992.
Effects of Cyclosporin A
and FK506 on Fc R1 initiated increases in cytokine mRNA
in mouse bone marrow derived mast cells.
Proc. Natl. Acad.
Sci. USA.
89:
8542-8546
|
| 25. | Weiss, D., J. Hural, D. Tara, L. Timmerman, G. Henkel, and M. Brown. 1996. Nuclear factor of activated T cells is associated with a mast cell interleukin 4 transcription complex. Mol. Cell Biol. 16: 228-235 [Abstract] . |
| 26. |
Hutchinson, L., and
M. McCloskey.
1995.
Fc R1 mediated
induction of nuclear factor of activated T cells.
J. Biol. Chem.
270:
16333-16338
|
| 27. |
Prieschl, E.,
G. Pendl,
N. Harrer, and
T. Baumruker.
1995.
p21Ras links Fc R1 to NF-AT family member in mast cells:
the AP-3 like factor in these cells is an NFAT family member.
J. Immunol.
155:
4963-4970
[Abstract]
.
|
| 28. | Price, M., A. Rogers, and R. Treisman. 1995. Comparative analysis of the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET). EMBO (Eur. Mol. Biol. Organ.) J. 14: 2589-2601 [Medline] . |
| 29. | Nobes, C., and A. Hall. 1995. Rho, Rac and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibres, lamellipodia and filopodia. Cell. 81: 53-62 [Medline] . |
| 30. | Williams, D.H., M. Woodrow, A.D. Cantrell, and J.E. Murray. 1995. Protein kinase C is not a downstream effector of p21ras in activated T cell. Eur. J. Immunol. 25: 42-47 [Medline] . |
| 31. | Treisman, R.. 1994. Ternary complex factors: growth factor regulated transcriptional activators. Curr. Opin. Genet. Dev. 4: 96-101 [Medline] . |
| 32. | Leevers, S., H. Paterson, and C. Marshall. 1994. Requirement for Ras in Raf activation is overcome by targeting Raf to the plasma membrane. Nature (Lond.). 369: 411-414 [Medline] . |
| 33. |
Alessi, D.,
A. Cuenda,
P. Cohen,
D. Dudlet, and
A. Saltiel.
1995.
PD098059 is a specific inhibitor of the activation of
mitogen-activated protein kinase kinase in vitro and in vivo.
J. Biol. Chem.
270:
27489-27494
|
| 34. | Genot, E., S. Cleverley, S. Henning, and D.A. Cantrell. 1996. Multiple p21ras effector pathways regulate nuclear factor of activated T cells. EMBO (Eur. Mol. Biol. Organ.) J. 15: 3923-3933 [Medline] . |
| 35. | Hill, C.S., J. Wynne, and R. Treisman. 1995. The Rho family GTPases RhoA, Rac1 and CDC42Hs regulate transcriptional activation by SRF. Cell. 81: 1159-1170 [Medline] . |
| 36. |
Whitmarsh, A.,
P. Shore,
A. Sharrocks, and
R. Davis.
1995.
Integration of MAP kinase signal transduction pathways at
the serum response element.
Science (Wash. DC).
269:
403-407
|
| 37. | Rao, A.. 1994. NF-ATp: a transcription factor required for the co-ordinate induction of several cytokine genes. Immunol. Today. 15: 274-281 [Medline] . |
| 38. | Hodge, M., A. Ranger, F.C. de la Brousse, T. Hoey, M. Grusby, and L. Glimcher. 1996. Hyperproliferation and dysregulation of IL-4 expression in NFATp-deficient mice. Immunity. 4: 397-405 [Medline] . |
| 39. |
Woodrow, M.,
N.A. Clipstone, and
D. Cantrell.
1993.
p21ras and calcineurin synergize to regulate the nuclear factor
of activated T cells.
J. Exp. Med.
178:
1517-1522
|
| 40. | Northrop, J., S. Ho, L. Chen, D. Thomas, L. Timmerman, G. Nolan, A. Admon, and G. Crabtree. 1994. NF-AT components define a family of transcription factors targeted in T-cell activation. Nature (Lond.). 369: 497-502 [Medline] . |
| 41. | Hoey, T., Y. Sun, K. Williamson, and X. Xu. 1995. Isolation of two new members of the NF-AT gene family and functional characterization of the NF-AT proteins. Immunity. 2: 461-472 [Medline] . |
| 42. | Manser, E., T. Leung, H. Salihuddin, Z. Zhao, and L. Lim. 1994. A brain serine/threonine protein kinase activated by Cdc42 and Rac1. Nature (Lond.). 367: 40-46 [Medline] . |
| 43. | Chou, M., and J. Blenis. 1996. The 70 kDa S6 kinase complexes with and is activated by the Rho family G Proteins Cdc42 and Rac1. Cell. 85: 573-583 [Medline] . |
| 44. | Symons, M.. 1996. Rho family GTPases: the cytoskeleton and beyond. TIBS (Trends Biochem. Sci.) 21: 178-181 [Medline] . |
| 45. | Cuenda, A., J. Rouse, Y.N. Doza, R. Meier, P. Cohen, T.F. Gallagher, P.R. Young, and J.C. Lee. 1995. SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett. 364: 229-233 [Medline] . |
| 46. | Van Aelst, L., T. Joneson, and D. Bar-Sagi. 1996. Identification of a novel Rac-1 interacting protein involved in membrane ruffling. EMBO (Eur. Mol. Biol. Organ.) J. 15: 3778-3786 [Medline] . |
| 47. | Hall, A.. 1994. Small GTP-binding proteins and the regulation of the actin cytoskeleton. Ann. Rev. Cell Biol. 10: 31-54 . |
| 48. |
Satoh, T.,
M. Nakafuku,
A. Miyajima, and
Y. Kaziro.
1991.
Involvement of p21ras in signal transduction pathways from
interleukin 2, interleukin 3 and granulocyte/macrophage colony stimulating factor, but not from interleukin 4.
Proc. Natl.
Acad. Sci. USA.
88:
3314-3318
|
| 49. | Schlaepfer, D.D., S.K. Hanks, T. Hunter, and P. van der Geer. 1994. Integrin-mediated signal transduction linked to Ras pathway by GRB2 binding to focal adhesion kinase. Nature (Lond.). 372: 786-791 [Medline] . |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||