|
||
-Ig
By
From the Laboratory of Molecular Immunology, The Howard Hughes Medical Institute, The Rockefeller University, New York 10021
The pre-B cell receptor is a key checkpoint regulator in developing B cells. Early events that
are controlled by the pre-B cell receptor include positive selection for cells express membrane immunoglobulin heavy chains and negative selection against cells expressing truncated immunoglobulins that lack a complete variable region (Dµ). Positive selection is known to be mediated by membrane immunoglobulin heavy chains through Ig
-Ig
, whereas the mechanism for counterselection against Dµ has not been determined. We have examined the role of the
Ig
-Ig
signal transducers in counterselection against Dµ using mice that lack Ig
. We found
that Dµ expression is not selected against in developing B cells in Ig
mutant mice. Thus, the
molecular mechanism for counterselection against Dµ in pre-B cells resembles positive selection in that it requires interaction between mDµ and Ig
-Ig
.
The object of B lymphocyte development is to produce
cells with a diverse group of clonally restricted antigen
receptors that are not self reactive (1). Antigen receptor diversification is achieved through regulated genomic rearrangements that result in the random assembly of Ig gene
segments into productive transcription units (2, 3). These
gene rearrangements are in large part regulated by the preB cell receptor (BCR)1.
B cells undergoing Ig heavy chain gene rearrangements
(pre-B) can express at least two types of BCRs. One form
of the receptor is composed of membrane immunoglobulin
heavy chain (mIgµ), Mice.
Ig Fluorescence Analysis and Cell Sorting.
Single cell suspensions prepared from bone marrow or spleen were stained with PE-labeled
anti-B220 and FITC-labeled anti-CD43 (PharMingen, San Diego, CA) or FITC-labeled anti-IgM, and analyzed on a FACScan®.
For cell sorting, bone marrow cells from four to six mice were stained with the same reagents and separated on a FACSvantage®.
CD43+B220 DNA and PCR.
Total bone marrow DNA was prepared for
PCR as previously described (22). DNA from sorted cells was
prepared for PCR in agarose plugs (23). Primers for VH-DJH and
DH-JH rearrangement were as in reference 22; these primers are
mouse specific and do not detect the human Igµ transgene. All
experiments were performed a minimum of three times with two
independently derived DNA samples. Nonrearranging Ig gene
intervening sequences were amplified in parallel with other reactions and used as a loading control (22). Amplified DNA was visualized after transfer to nylon membranes by hybridization with
a 6-kb EcoR1 fragment that spans the mouse JH region.
Isolation and Sequencing of VH-DJH and DH-JH Joints.
A JH4 primer
was combined with either a DH primer or a VHJ558L primer to
amplify DJH and VDJH rearrangements, respectively. The primers
were: (a) JH4, ACGGATCCGGTGACTGAGGTTCCT; (b) DH,
ACAAGCTTCAAAGCACAATGCCTGGCT; and (c) VHJ558L,
GCGAAGCTTA(A,G)GCCTGGG(A,G)CTTCAGTGAAG. PCR
amplification for DJH joints was for 35 cycles of 0.5 min at 94°C,
and 2 min at 72°C; for VDJH joints, it was for 0.5 min at 94°C, 1 min at 68°C, and 1.5 min at 72°C. PCR products were purified
by agarose gel electrophoresis, subcloned into pBluescript, sequenced
using an Applied Biosystems (Foster City, CA) DNA sequencing
kit, and analyzed on a genetic analyzer (ABI-310; Applied Biosystems).
Expression of Ig To determine whether mIgµ could induce the pre-B
cell transition in the absence of Ig
Allelic exclusion is established as early as the CD43+
B220+ stage of B cell development (31). This early
stage of development is found in the bone marrow of Ig
Igs with DH
joined to JH in RF2 are rarely found in mature B cells (15).
Genetic experiments in mice have shown that counterselection against RF2 requires the transmembrane domain of
mIgµ and the syk tyrosine kinase (15, 18). To determine
whether counterselection is mediated through Ig
VH to DJH joining and counterselection are normally
completed in CD43+B220+ pre-B cells (31), but in
Ig
The transmembrane domain of mIgµ is required to produce the signals that mediate several antigen-independent
events in developing B cells, including allelic exclusion and
the pre-B cell transition (24, 36). However, mIgµ itself
is insufficient for signal transduction (40), and it requires
the Ig The earliest developmental checkpoint regulated by Ig Two models have been proposed to explain counterselection against mDµ. The first model states that mDµ is
toxic, and that cells expressing this protein are deleted by a
mechanism that involves inhibition of proliferation (31). A
second theory postulates that Dµ proteins produce the signal for heavy chain allelic exclusion and block the completion of productive heavy chain gene rearrangements (15).
According to this second model, cells expressing mDµ are then unable to continue along the B cell pathway. Support
for the active signaling model comes from three sets of observations: (a) that there is no counterselection in the absence of a Igµ transmembrane exon (15); (b) that there is
no RF counterselection in the absence of syk (18); and (c)
that there is no counterselection in early CD43+B220+ B
cell precursors in the absence of Why does the expression of the Dµ pre-BCR lead to arrested development, whereas mature mIgµ in the same complex activates positive selection in early B cells? Both signals
are produced in CD43+B220+ pre-B cells, both require Two alternative explanations for the disparate cellular responses to the Dµ pre-BCR and the mIgµ pre-BCR are:
(a) that there are qualitative differences between signals
generated by a mDµ and a mIgµ receptor complex, and (b)
pre-B-I cells that contain DJH rearrangements are in a different stage of differentiation than pre-B-II cells that have
completed VDJH and express mIgµ (8). An example of two
qualitatively distinct signals resulting in alternative biologic
responses has been found in the highly homologous TCR
receptor (46, 47). TCR interaction with ligand can produce either anergy or activation, depending on the affinity of the TCR for the peptide-MHC complex (48). High affinity ligands that produce T cell responses fully activate
CD3 tyrosine phosphorylation, whereas peptides that induce anergy bind with low affinity and induce a reduced
level of CD3 phosphorylation. The low level CD3 phosphorylation induced by the anergizing peptides is associated with less than optimal ZAP-70 kinase activation (46, 47).
Less is known about the physiologic responses activated by Ig We would like to propose that positive and negative selection in developing B cells, like activation and anergy in
T cells, may be mediated by differential phosphorylation of
Ig
5, V-pre-B, and Ig
-Ig
, and is referred to as the pre-BCR (4). A second form of the preB cell receptor, known as the Dµ pre-BCR (7), is found
only in pre-B1 cells (8) and contains truncated mIgµ chains
lacking a VH domain (mDµ). mDµ is produced by Ig genes that have rearranged DJH gene segments in reading frame
(RF) 2 producing an in-frame start codon and a truncated
transcription unit (7). Like authentic mIgµ, mDµ is a membrane protein that forms a complex with
5, V-pre-B, and
Ig
-Ig
, and in tissue culture cell lines the Dµ pre-BCR
can activate cellular signaling responses (9). But despite
its ability to activate nonreceptor tyrosine kinases, Dµ preBCR producing pre-B cells are selected against by a process that is mediated through the transmembrane domain of
the mDµ protein (15). In contrast, pre-B cells that express intact mIgµ containing pre-BCRs are positively selected.
Counterselection is reflected in the relative lack of mature
B cells that express mIgµ in RF2 (15). The mechanism
by which mDµ activates counterselection has not been defined, but is known to require expression of syk (18). Here
we report on experiments showing that Ig
is essential for
counterselection against mDµ in vivo.

/
, mIgµ, and Bcl-2 transgenic strains have been
previously described and were maintained by backcrossing with
BALB/c mice under specific pathogen-free conditions (19).
All experiments were performed with 4-8-wk-old female mice.
and CD43+B220+ cells were collected based on
gating with RAG-1
/
controls.
mIgM Cannot Induce the Pre-B Cell Transition or Allelic Exclusion in the Absence of Ig
.
is required
for B cells to efficiently complete Ig VH to DJH gene rearrangements (19). B cells in Ig
/
mice fail to express normal levels of mIgµ, and B cell development is arrested at
the CD43+B220+ pre-B1 stage (19). A similar celltype specific developmental arrest is also found in mice that carry a
mutation in the transmembrane domain of mIgµ (24), and
mice that fail to complete Ig V(D)J recombination (25).
In view of the abnormally low levels of mIgµ in Ig
/
mice, failed pre-B cell development might simply be due to
lack of Ig expression.
, we introduced a productively rearranged immunoglobulin gene (20) into the
Ig
/
background (TG.mµ Ig
/
). We then measured
B cell development by staining bone marrow cells with antiCD43 and anti-B220 monoclonal antibodies (30). We
found that expression of a pre-rearranged Ig transgene was not sufficient to activate the pre-B cell transition in the absence of Ig
(Fig. 1). TG.mµ Ig
/
B cells did not develop past the CD43+B220+ pre-B cell stage (Fig. 1). In
control experiments, the same mIgµ transgene did induce
the appearance of more mature CD43
B220+ pre-B cells
in a RAG
/
mutant background where B cell development was similarly arrested at the CD43+B220+ stage (20, 25, 26; data not shown). We conclude that in the absence of Ig
, a productively rearranged mIgµ is unable to activate the pre-B cell transition.
Fig. 1.
Flow cytometric analysis
of spleen (Spl) and bone marrow cells
(BM) from Ig
/
, transgenic, and
wild-type mice. Single-cell suspensions from lymphoid organs of 6-wkold mice were prepared and analyzed
on FACScan®. Bone marrow cells
were stained with PE-anti-B220 and
FITC-anti-CD43. Spleen cells were
stained with FITC-anti-IgM and PE-
anti-B220. The lymphocyte population was gated according to standard
forward- and side-scatter values. The
numbers in each quadrant represent the percentages of gated lymphocytes.
WT, wild type; RAG
/
, RAG-1
mutant; Ig
/
, Ig
mutant; Ig
/
µ.TG, Ig
mutant, mIgµ, transgenic.
[View Larger Version of this Image (33K GIF file)]

/
mice (19). However, we were initially unable to measure
allelic exclusion in Ig
mutant mice due to the low efficiency of complete Ig VH to DJH gene rearrangements and
absence of surface Igµ expression (19). To determine
whether expression of mIgµ could activate allelic exclusion
in TG.mµ Ig
/
mice, we measured inhibition of VH to
DJH gene rearrangements by PCR (34). In controls, the
mIgµ transgene inhibited VH to DJH gene rearrangement
(22), but the same transgene had no effect in the Ig
/
background (Fig. 2). We had previously shown that the cytoplasmic domains of Ig
and Ig
are sufficient to activate
allelic exclusion (20, 35). The finding that mIgµ is unable
to induce allelic exclusion in the absence of Ig
suggests
that Ig
is essential for allelic exclusion.
Fig. 2.
Ig gene rearrangements in Ig
/
, transgenic, and wild-type
mice. Bone marrow DNA from 6-wk-old mice was amplified with
VH558L, VH7183 (not shown), or DH and JH2 primers. Control primers
were from the J-CH1 intervening sequence (IVS) (22).
[View Larger Version of this Image (68K GIF file)]
Is Required for RF2 Counterselection.
, we sequenced DJH joints amplified from sorted CD43+B220+
pre-B cells from Ig
/
mice and controls. In control samples, only 10% of the DJH joints were in RF2 (Fig. 3),
which is in agreement with similar measurements performed in other laboratories (15, 31). In contrast,
there was no counterselection in the bone marrow cells of
Ig
/
mice; 13 out of 30 DJH joints were in RF2 with the
remainder being distributed in RF1 and 3 (Fig. 3). Thus, in
the absence of Ig
, there was no RF2 counterselection at
the level of DJH rearrangements in CD43+B220+ cells in
the bone marrow.
Fig. 3.
Nucleotide sequences of DH-JH joints from Ig
/
and wild-type sorted bone marrow B cells. DH segment, N or P nucleotides, and JH4 segment sequences are shown. The number of DJH4 joints in DH RF 1, 2, or 3 are noted. Stop codons in DH segments are underlined.
[View Larger Version of this Image (47K GIF file)]

/
mice, VH to DJH joining is inefficient (19). To determine whether RF2 was counterselected in the few Ig
mutant B cells that completed VH to DJH rearrangements,
we amplified and sequenced VHJ558L-DJH4 joints from
unfractionated bone marrow cells (Fig. 4). As with the DJH
joints, we found no evidence for counterselection against RF2 in VDJH joints in Ig
/
B cells. 10/33 VHJ558LDJH4 joints sequenced from Ig
/
mice were in RF2. By
contrast, RF2 was only found in 1 of 11 mature Ig's in the
controls. The VDJH and DJH Ig
/
joints otherwise resembled the wild type in the number of N and P nucleotides as well as in the extent of nucleotide deletion (Figs. 3
and 4). We conclude that there was no selection against RF2 in the absence of Ig
, and that the absence of Ig
has
no significant impact on the mechanics of recombination as
measured by the variability of the joints.
Fig. 4.
Nucleotide sequences of V(D)J (VH558L to DJH4) joints from Ig
/
and wild-type bone marrow B cells. DH segment, N or P nucleotides, and JH4 segment sequences are shown. The number of DJH4 joints in DH RF 1, 2, or 3 are noted. Stop codons in DH segments are underlined, and the
DH segments used (S) are indicated.
[View Larger Version of this Image (27K GIF file)]
and Ig
signaling proteins to activate B cell responses in vitro and in vivo.
Ig
appears to involve either activation of cellular competence to complete VH to DJH rearrangements, or positive
selection for cells that express mIgµ (19). In the next phase
of the B cell pathway, the same transducers are necessary
(Fig. 2) and sufficient to produce the signals that activate allelic exclusion and the pre-B cell transition (19, 20, 35, 41).
In the present report, we show that in addition to these
functions, Ig
-Ig
transducers are also necessary for negative selection against Dµ.
5 (33). These experiments partially define the receptor structure for counterselection as composed of mDµ associated with
5. Our observation that negative selection against Dµ does not occur
in the absence of Ig
supports the signaling model, and
identifies Ig
-Ig
as the transducers that activate counterselection possibly by linking mDµ to nonreceptor tyrosine kinases.
5
(33, 39, 42), and the Ig
-Ig
coreceptors (19, 41), and both
are transmitted through a cascade that induces syk (18, 43).
One way to explain the difference between the cellular response to mDµ pre-BCR and mIgµ pre-BCR expression
might be an inability of Dµ to pair with conventional
or
Ig light chains (14). According to this model, cells expressing mDµ should be trapped in the CD43
B220+ preB cell compartment since B cell development can progress
to the CD43
B220+ stage in the absence of conventional
light chains (44, 45). However, elegant single cell sorting
experiments have shown that mDµ-producing cells are selected against before this stage in CD43+B220+ pre-B cells
(33, 42). Thus, the idea that abnormal pairing of mDµ
with light chains is responsible for counterselection fails to
take into account the observation that counterselection
normally occurs independently of light chain gene rearrangements.
-Ig
in developing B cells, but experiments
in transgenic mice have shown that early B cell development requires tyrosine phosphorylation of Ig
(20), and by
inference, receptor cross-linking. Although the cytoplasmic
domains Ig
and Ig
appear to have redundant functions in
allelic exclusion and the pre-B cell transition (20, 35), neither Ig
, (41) nor Ig
(Papavasiliou, N., and M.C. Nussenzweig, manuscript in preparation) alone are able to fully
restore B cell development in the bone marrow, suggesting
that there are specific functions for Ig
and Ig
, or the Ig
Ig
heterodimer. Biochemical support for the idea that individual coreceptors could have unique biologic functions
also comes from transfection experiments in B cell lines
(49) and from the observation that the cytoplasmic domains of Ig
and Ig
bind to different sets of nonreceptor
tyrosine kinases (52).
and Ig
in the pre-BCR. Given the requirement for
cross-linking in pre-BCR activation, the mechanism that
produces the proposed differential phosphorylation of the
mDµ and mIgµ pre-BCRs may be a function of their affinities for the cross-linker.
Address correspondence to Dr. Michel Nussenzweig, The Rockefeller University, Howard Hughes Medical Institute, 1230 York Ave., New York, NY 10021.
Received for publication 13 September 1996
This work was supported by the Howard Hughes Medical Institute, and by National Institutes of Health grants to Dr. Nussenzweig.We thank members of the Nussenzweig laboratory for their helpful suggestions and advice.
| 1. | Rajewsky, K.. 1996. Clonal selection and learning in the antibody system. Nature (Lond.). 381: 751-758 [Medline] . |
| 2. | Tonegawa, S.. 1983. Somatic generation of antibody diversity. Nature (Lond.). 302: 575-581 [Medline] . |
| 3. | Alt, F.W., G.D. Yancopoulos, K.T. Blackwell, E. Wood, M. Boss, R. Coffman, N. Rosenberg, S. Tonegawa, and D. Baltimore. 1984. Ordered rearrangements of immunoglobulin heavy chain variable region segments. EMBO (Eur. Mol. Biol. Organ.) J. 3: 1209-1219 [Medline] . |
| 4. |
Pillai, S., and
D. Baltimore.
1987.
Formation of disulfide
linked µ2 2 tetramers by the 18 KD -immunoglobulin
light chain.
Nature (Lond.).
329:
172-174
[Medline]
.
|
| 5. |
Karasuyama, H.,
A. Kudo, and
F. Melchers.
1990.
The proteins encoded by V pre-B and 5 pre-B cell specific genes
can associate with each other and with µ heavy chain.
J. Exp.
Med.
172:
969-972
|
| 6. |
Tsubata, T., and
M.G. Reth.
1990.
The products of the pre-B
cell specific genes ( 5 and V pre-B) and the immunoglobulin
µ chain form a complex that is transported to the cell surface.
J. Exp. Med.
172:
973-976
|
| 7. | Reth, M.G., and F.W. Alt. 1984. Novel immunoglobulin heavy chains are produced from DJH gene segment rearrangements in lymphoid cells. Nature (Lond.). 312: 418-423 [Medline] . |
| 8. | Rolink, A., and F. Melchers. 1991. Molecular and cellular origins of B lymphocyte diversity. Cell. 66: 1081-1094 [Medline] . |
| 9. |
Nomura, J.,
T. Matsuo,
F. Kubola,
M. Kimoto, and
N. Sakaguchi.
1991.
Signal transmission through the B cell specific
MB-1 molecule at the pre-B cell stage.
Int. Immunol.
3:
117-126
|
| 10. |
Misener, V.,
G.P. Downey, and
J. Jongstra.
1991.
The immunoglobulin light chain related protein 5 is expressed on
the surface of pre-B cell lines and can function as a signaling
molecule.
Int. Immunol.
3:
1-8
|
| 11. | Takemori, T., J. Mizuguchi, I. Miyazoe, M. Nakanishi, K. Shigemoto, H. Kimoto, T. Shirasawa, N. Maruyama, and M. Taniguchi. 1990. Two types of µ chain complexes are expressed during differentiation from pre-B to mature B cells. EMBO (Eur. Mol. Biol. Organ.) J. 9: 2493-2500 [Medline] . |
| 12. |
Tsubata, T.,
R. Tsubata, and
M.G. Reth.
1992.
Cross-linking of the cell surface immunoglobulin (µ surrogate light
chain complex) on pre-B cells induces activation of V gene
rearrangements at the immunoglobulin locus.
Int. Immunol.
4:
637-641
|
| 13. | Tsutsumi, A., J. Terajima, W. Jung, and J. Ransom. 1992. Surface µ heavy chain expressed on pre-B lymphomas transduces Ca++ signals but fails to cause arrest of pre-B cell lymphomas. Cell. Immunol. 139: 44-57 [Medline] . |
| 14. | Horne, M.C., P.E. Roth, and A.L. DeFranco. 1996. Assembly of the truncated immunoglobulin heavy chain Dµ into antigen receptor-like complexes in pre-B cells but not in B cells. Immunity. 4: 145-158 [Medline] . |
| 15. | Gu, H., D. Kitamura, and K. Rajewsky. 1991. B cell development regulated by gene rearrangement: arrest of maturation by membrane-bound Dµ protein and selection of DH element reading frames. Cell. 65: 47-54 [Medline] . |
| 16. |
Meek, K..
1990.
Analysis of junctional diversity during B lymphocyte development.
Science (Wash. DC).
250:
820-823
|
| 17. | Kaartinen, M., and O. Makela. 1985. Reading of D genes in variable frames as a source of antibody diversity. Immunol. Today. 6: 324-330 . |
| 18. | Cheng, A.M., B. Rowley, W. Pao, A. Hayday, J.B. Bolen, and T. Pawson. 1995. Syk tyrosine kinase required for mouse viability and B cell development. Nature (Lond.). 378: 303-306 [Medline] . |
| 19. |
Gong, S., and
M.C. Nussenzweig.
1996.
Regulation of an
early developmental checkpoint in the B cell pathway by Ig .
Science (Wash. DC).
272:
411-414
[Abstract]
.
|
| 20. |
Papavasiliou, F.,
Z. Misulovin,
H. Suh, and
M.C. Nussenzweig.
1995.
The role of Ig in precursor B cell transition
and allelic exclusion.
Science (Wash. DC).
268:
408-411
|
| 21. | Vaux, D.L., S. Cory, and J. Adams. 1988. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature (Lond.). 335: 440-442 [Medline] . |
| 22. |
Costa, T.E.F.,
H. Suh, and
M.C. Nussenzweig.
1992.
Chromosomal position of rearranging gene segments influences allelic exclusion in transgenic mice.
Proc. Natl. Acad. Sci. USA.
89:
2205-2208
|
| 23. |
Petree, H.P.,
F. Livak,
D. Burtrum, and
S. Mazel.
1995.
T
cell receptor gene recombination patterns and mechanisms:
cell death, rescue, and T cell production.
J. Exp. Med.
182:
121-127
|
| 24. | Kitamura, D., J. Roes, R. Kuhn, and K. Rajewsky. 1991. A B cell deficient mouse by targeted disruption of the membrane exons of the immunoglobulin µ chain gene. Nature (Lond.). 350: 423-426 [Medline] . |
| 25. | Mombaerts, P., J. Iacomini, R.S. Johnson, K. Herrup, S. Tonegawa, and V.E. Papaioannou. 1992. RAG-1 deficient mice have no mature B and T lymphocytes. Cell. 68: 869-877 [Medline] . |
| 26. | Shinkai, Y., G. Rathbun, K.-P. Lam, E.M. Oltz, V. Stewart, M. Mendelsohn, J. Charron, M. Datta, F. Young, A.M. Stall, and F.W. Alt. 1992. RAG-2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell. 68: 855-867 [Medline] . |
| 27. | Ehlich, A., S. Schaal, H. Gu, D. Kitamura, W. Muller, and K. Rajewsky. 1993. Immunoglobulin heavy and light chain genes rearrange independently at early stages of B cell development. Cell. 72: 695-704 [Medline] . |
| 28. | Nussenzweig, A., C. Chen, V. Soares, M. Sanchez, K. Sokol, M.C. Nussenzweig, and G.C. Li. 1996. Requirement for Ku80 in growth and immunoglobulin V(D)J recombination. Nature (Lond.). 383: 551-555 . |
| 29. | Zhu, C., M.A. Bogue, D. Lim, P. Hasty, and D.B. Roth. 1996. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell. 86: 379-389 [Medline] . |
| 30. |
Hardy, R.R.,
C.E. Carmack,
S.A. Shinton,
J.D. Kemp, and
K. Hayakawa.
1991.
Resolution and characterization of proB and pre-pro-B cell stages in normal mouse bone marrow.
J. Exp. Med.
173:
1213-1225
|
| 31. |
Haasner, D.,
A. Rolink, and
F. Melchers.
1994.
Influence of
surrogate light chain on DHJH-reading frame 2 suppression in
mouse precursor B cells.
Int. Immunol.
6:
21-30
|
| 32. | Ehlich, A., V. Martin, W. Muller, and K. Rajewsky. 1994. Analysis of the B cell progenitor compartment at the level of single cells. Curr. Biol. 4: 573-583 [Medline] . |
| 33. | Loffert, D., A. Ehlich, W. Muller, and K. Rajewsky. 1996. Surrogate light chain expression is required to establish immunoglobulin heavy chain allelic exclusion during early B cell development. Immunity. 4: 133-144 [Medline] . |
| 34. |
Schlissel, M.S.,
L.M. Corcoran, and
D. Baltimore.
1991.
Virus-transformed pre-B cells show ordered activation but not
inactivation of immunoglobulin gene rearrangement and
transcription.
J. Exp. Med.
173:
711-720
|
| 35. |
Papavasiliou, F.,
M. Jancovic,
H. Suh, and
M.C. Nussenzweig.
1995.
The cytoplasmic domains of Ig and Ig can
independently induce the pre-B cell transition and allelic exclusion.
J. Exp. Med.
182:
1389-1394
|
| 36. | Nussenzweig, M.C., E.V. Schmidt, A.C. Shaw, E. Sinn, J. Campos-Torres, B. Mathew-Prevot, P.K. Pattengale, and P. Leder. 1988. A human immunoglobulin gene reduces the incidence of lymphomas in c-Myc-bearing transgenic mice. Nature (Lond.). 336: 446-450 [Medline] . |
| 37. |
Nussenzweig, M.C.,
A.C. Shaw,
E. Sinn,
D.B. Danner,
K.L. Holmes,
H.C. Morse, and
P. Leder.
1987.
Allelic exclusion
in transgenic mice that express the membrane form of immunoglobulin µ.
Science (Wash. DC).
236:
816-819
|
| 38. |
Manz, J.,
K. Denis,
O. Witte,
R. Brinster, and
U. Storb.
1988.
Feedback inhibition of immunoglobulin gene rearrangement by membrane mu, but not by secreted mu heavy
chains (erratum published 169:2269).
J. Exp. Med.
168:
1363-1381
|
| 39. | Kitamura, D., and K. Rajewsky. 1992. Targeted disruption of mu chain membrane exon causes loss of heavy-chain allelic exclusion. Nature (Lond.). 356: 154-156 [Medline] . |
| 40. |
Costa, T.E.,
R.R. Franke,
M. Sanchez,
Z. Misulovin, and
M.C. Nussenzweig.
1992.
Functional reconstitution of an
immunoglobulin antigen receptor in T cells.
J. Exp. Med.
175:
1669-1676
|
| 41. | Torres, R.M., H. Flaswinkiel, M. Reth, and K. Rajewsky. 1996. Aberrant B cell development and immune response in mice with a compromised BCR complex. Science (Wash. DC). 272: 1804-1808 [Abstract] . |
| 42. | Loffert, D., S. Schaal, A. Ehlich, R.R. Hardy, Y.R. Zou, W. Muller, and R. Rajewsky. 1994. Early B-cell development in the mouse: insights from mutations introduced by gene targeting. Immunol. Rev. 137: 135-153 [Medline] . |
| 43. | Turner, M., P.J. Mee, P.S. Costello, O. Williams, A.A. Price, L.P. Duddy, M.T. Furlong, R.L. Geahlen, and V.L. Tybulewicz. 1995. Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature (Lond.). 378: 298-302 [Medline] . |
| 44. |
Spanopoulou, E.,
C.A.J. Roman,
L.M. Corcoran,
M.S. Schlissel,
D.P. Silver,
D. Nemazee,
M.C. Nussenzweig,
S.A. Shinton,
R.R. Hardy, and
D. Baltimore.
1994.
Functional immunoglobulin transgenes guide ordered B-cell differentiation in
Rag-1-deficient mice.
Genes Dev.
8:
1030-1042
|
| 45. |
Young, F.,
B. Ardman,
Y. Shinkai,
R. Lansford,
T.K. Blackwell,
M. Mendelsohn,
A. Rolink,
F. Melchers, and
F.W. Alt.
1994.
Influence of Immunoglobulin heavy- and light-chain
expression on B-cell differentiation.
Genes Dev.
8:
1043-1057
|
| 46. | Sloan-Lancaster, J., A.S. Shaw, J.B. Rothbard, and P.M. Allen. 1994. Partial T cell signaling: altered phospho-zeta and lack of zap-70 recruitment in APL induced T cell anergy. Cell. 79: 913-922 [Medline] . |
| 47. |
Madrenas, J.,
R.L. Wange,
J.L. Wang,
N. Isakov,
L.E. Samelson, and
R.N. Germain.
1995.
Zeta phosphorylation
without ZAP-70 activation induced by TCR antagonists or
partial agonists.
Science (Wash. DC).
267:
515-518
|
| 48. | Lyons, D.S., S.A. Lieberman, J. Hampl, J.J. Boniface, Y. Chien, L.J. Berg, and M.M. Davis. 1996. A TCR binds to antagonist ligands with lower affinities and faster dissociation rates than to agonists. Immunity. 5: 53-61 [Medline] . |
| 49. |
Kim, K.-M.,
G. Alber,
P. Weiser, and
M. Reth.
1993.
Differential signaling through the Ig- and Ig- components of
the B cell antigen receptor.
Eur. J. Immunol.
23:
911-916
[Medline]
.
|
| 50. |
Sanchez, M.,
Z. Misulovin,
A.L. Burkhardt,
S. Mahajan,
T. Costa,
R. Franke,
J.B. Bolen, and
M. Nussenzweig.
1993.
Signal transduction by immunoglobulin is mediated through
Ig and Ig .
J. Exp. Med.
178:
1049-1056
|
| 51. |
Luisiri, P.,
Y.J. Lee,
B.J. Eisfelder, and
M.R. Clark.
1996.
Cooperativity and segregation of function within the Ig-alpha/
beta heterodimer of the B cell antigen receptor complex.
J.
Biol. Chem.
271:
5158-5163
|
| 52. |
Clark, M.R.,
K.S. Campbell,
A. Kazlauskas,
S.A. Johnson,
M. Hertz,
T.A. Potter,
C. Pleiman, and
J.C. Cambier.
1992.
The B cell antigen receptor complex: association of Ig-alpha
and Ig-beta with distinct cytoplasmic effectors.
Science (Wash.
DC).
258:
123-126
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| TABLE OF CONTENTS |
|